I got stuck with a performance problem while writing my program and I need your help! :)
I'm using a JTable to view test results taken from a vector I made and it has 4 columns in it. When I click on a row the details from a saved txt file of that test are shown in a child window. Also, when I click on the columns header the event sends the vector to a function that sorts it according to the pressed column. Every time a new value needs to be entered the sorting function is called again.
My program works fine with a small number of rows. But, when I enter say, 150 rows, every time I enter a new row the Table flicks (the sort probably takes a lot of time), but I have to keep the vector synchronized with the jable because of the "push to view the result" option.
I would really appreciate some help with this.
thanks
You shouldn't have to do any sorting yourself. JTable supports sorting natively, and has the convertRowIndexToModel and convertRowIndexToView methods to go from the view index to the model index and vice-versa.
See http://docs.oracle.com/javase/tutorial/uiswing/components/table.html#sorting.
Use JTable's internal sorter (DefaultRowSorter). Do not re-create the vector which holds the data - use Vector's add() method to add new records. In many years of Java GUI development I haven't seen a single case where I had to keep records in the TableModel sorted. Make sure getColumnClass() returns a proper type, so the default sorter knows how to sort the column, and that is all.
Related
I have a java program which keeps records of databases. I have made use of JComboBox for adding data to my db system. I have to initialize more than 10000 string into my JComboBox. I have used keylistener to make my program auto search elements inside JComboBox.
The problem is that it is taking a lot of time to search a single key. Is there a programming technique to make search faster with keylistener for more than 10000 string elements in JComboBox. Should I have to make use of multithreading to keylistener?
Generally:
Never show so much elements at once into a List,Table,ComboBox etc. It makes the program lags and you spent a lot of memory.Maximum items to be shown per time must be <=300.Basically the comboBox its not so good idea a list or table will fit better.
How?
Every time the list shows 300 items,the user can use next button to load the next 300 from the database or previous button to load the 300 previous items.
About Search:
On every key pressed by user you search into database table you have for the 300 or less best fitting the result and then you add them into the List and ComboBox removing the previous items first.
More about search:
If you want you can retrieve all the items matching to search and use pagination for search results.
I have some JDialogs displaying JTables.
When the header columns are clicked a sort occurs on that column.
My question is : how can I know when a column header has been clicked and thus made a sort active.
When the sort is active, I know I should user the .convertRowIndexToModel method.
But how do I detect that a column is sorting in order not to mess the correct index if no sort is active?
Generally speaking, you should ALWAYS uses the convertRowIndexToModel when you take an index value from the view (JTable) and try and look up some value within the model. The JTable does this automatically when you use it's methods, but incase you're not, you need to take care of it yourself.
There's no need to know if the view is sorted or not...
If you "really" want to know when a table is sorted, you could attach a RowSorterListener to the TableRowSorter used by the table.
You could also use the TableRowSorter#getSortKeys to see which columns are included in the sort...
I have used it for my selection table. When the auto order is activated (setAutoCreateRowSorter(true))
the indices of the model table and the visual change, so you have to tell it to look for it within the model with respect to the one you are seeing.
((CustomTable)form.getAvailListView().getModel()).data.get(form.getListView().convertRowIndexToModel(i))
I have a JTable with two columns and a table model that uses a class which works with a hash map. The elements of this map are the table rows.
Every time I add a new element I need the element to be selected, regardless of any sorting. Now, I've tried using the following method:
int lastRow = table.convertRowIndexToView(tableModel.getRowCount() - 1);
table.setRowSelectionInterval(lastRow, lastRow);
The problem is, this works only when I'm adding data in a sorted fashion (e.g. "A", "B", "C" and not even then since "D", for example, is placed ahead of A once added). Could someone tell me how to solve this problem?
The problem is most likely in your TableModel, since the code you posted is just fine. You mention you use a HashMap for storing the data of your TableModel. Problem with a HashMap is that it hasn't any ordering. Adding an element to it might alter the order in which you get the elements in the map.
Better to use a data structure which respects the ordering.
better could be to use prepareRendered for hightlighting max row index from XxxTableModel
JTable could be Sorted and Filtered too, then last added row couldn't be visible in JTables view
depends of ListSelectionMode, but by default you can do
table.setRowSelectionInterval(lastRow, lastRow);
table.setColumnSelectionInterval(columnMinIndex, columnMaxIndex);
for better help sooner post an SSCCE, short, runnable, compilable, just about JFrame, JTable in JScrollPane and a new addRow fired from swing.Timer
I'm using Eclipse Indigo SR1 with JDK 1.7, on Windows 7 Pro.
I've written a desktop app, Swing based.
My app includes a JTable; it shows many records of type T, one row per record.
The table model points to Vector vect, named vect, containing all data to be shown in the JTable.
The app includes a combo, named sele, showing three values: 0, 1, 2.
When sele = 0, every record of vect has to be visible in the JTable.
When sele = 1, the JTable has to show only vect records having odd row index and all records with even row index mustn't be visible. Viceversa, when sele = 2.
So, here's my question: how can I make a row not visible in the JTable ?
I can't use the table model, because it points to vect that contains "all" data.
I tried a table cell renderer, but it seems that you can set the color of a cell, but you can't set it not visible or modify its size.
I've tried another way: if r is the row index, and I want that row to be not visible, I write table.setRowHeight(r,0), but this instruction throws an exception, the height can't be set to zero.
I could solve the problem by splitting the data, dividing vect in two, but I don't like that.
Does anybody have an idea ?
thanx in advance,
William
PS: someone told me to create a filtering TableModel that wraps the existing TableModel. The filtering model would be sensitive to the filtering criteria and fire the appropriate methods (TableDataChanged) when the filter was changed. The getRowCount method would return the filtered count. The getValueAt method would map the filtered row to the actual row in the underlying TableModel.
Mah, perhaps it's a good idea, but frankly I'm not able to understand it...
Use a TableRowSorter - which is:
An implementation of RowSorter that provides sorting and filtering using a TableModel. ..
See How to Use Tables & especially Sorting and Filtering for more info.
Here is a typical input .txt file (also called as fasta file):
>contig00001 length=586 numreads=4
CGGGAAATTATCcGCGCCTTCACCGCCGCCGGTTCCACCGACGAACGGATACTGCGtGaa
ggCCGCGATCCCGTCggaCGGAAAaCGCCcTGGCCCGGGAaCATACCGTTCGGGCCGCCA
AGTGTTATAGCCGGACCACTTGTCAGAACATTTCCaaTCCGAAGATGTGAGTtCGGAAGg
TAAAAGCCCGACAAGTTGCGCGgTGAATTTACCTTtACcGCACGATATGCGTCCGTATTA
AaGAAAaGTTCGAAATTATCAGTAAGGCCGACCTGAAaGCTGACCGGGAGTTCAACAAAA
TCTGCATCACCcGGgTCACGGTCGAAATTGCTGTACGCGGCGCTGAACGTAAATTCACCC
TTTcTAAGGGTGTCGCcGTCGTAAACCGTAAaCAaGCCGGTAGCGCCGCCCATCGGGCCG
CCGGTACCAACCGTCGGTGCCGTGTTTCTtGCATCATTGTCCGATCGAGCGTTCTCGTCC
GCTTGTGCAAaTCCTGCAaTAGCTAACGTGAAAACGATCAGAGCTGTTGTAAATACTCTA
TAAGCGAGATTCATCACATTCCTCcGCCGAAATAAAAAGTTAATTt
>contig00002 length=554 numreads=4
TGCGCCAaCCGCGCTCTtCATAAaTGGGCACTGCTCCCGATGGCCgACTCGGGCGGTTCG
CCATGAGATCTTTGCCtACCcAGgAaCtCACcACCAAGTCTGATTGCTGTGTGTTTtCTT
CAAGTCCCTATTTCTATTCtCTTtAATGGAACCCGTAGGAAACCCGTGTAGGACGCGGGA
aCCGCACTTgAAGGGGGAGGCGCGGGGTACCGGtCCGGGAACGTACGGGTACCGGCGGGG
gAGGGGAGGGGGACCgCTCCGGGAAGGCCAGGGGACGGATTGGGGAAGGgCGGGTACCGA
AGCGGGgAAaTGGGggAaCcGGCGAGAGGGTTCCTCGCTAAGTGGGGGAAATaGGGGAAA
GGTTGACCAGTGGTtCCCcGCTCTCGTAACATGCCTCAGATAGCGCCATCCGCTGTACCT
GGtcaggtcGctggcaacttcggccgagcaggtgaacccgaaaggtgagggtcagtgtga
cacaccaaccgaacaccgacgaggcaagcgtaggagccggcgtggccgcgcccggcggcg
ctgaggactcctcg
Code to read the sequence may be found here.
It gives the proper output, as shown below with tab seperation:
contig00001 586 52.38
contig00002 554 62.45
The problem is that I developed a form in NetBeans that consists of a JTable having 5 columns i.e:
"contigID","Description","Organism","Sequence_length","Gc_percentage"
and a JTextArea. I want to display the above output in the JTable columns, while the other columns remain empty; and when I click 'contig00001' in JTable, then respective sequence like "CGGGAAAT...." should be displayed in the JTextArea.
How can I do that? Any suggestion would be appreciated.
I'm not exactly sure what you're stuck on. If it's adding data to the JTable, I'd consider creating a DefaultTableModel object, constructing it with the correct column header Strings in an array, with 0 rows of data, and then adding rows of data as you read through your files. The JTable tutorial should help you do all of this. Once you have your table model created, you can add it to your JTable easily via its setModel method.
One approach is to extend AbstractTableModel, as discussed in Creating a Table Model.
Addendum: By listening for a user selection, you can determine which row was selected and update your JTextArea accordingly.
Addendum: Because data retrieval may be prtotracted, SwingWorker offers a safe way to mutate the TableModel. Here's a simple example.