We Keep Coding

How do I fix this Java BubbleSort algorithm?

I'm doing a Java programming assignment which involves bubble sorting a .dat file BetelgeuseNames.dat with strings in it alphabetically. My AP Computer Science A teacher told me my code is correct, but it still gives the wrong output.
There are three classes called BubbleSort, BubbleSortTimer, and StopWatch. The program runs from BubbleSortTimer.
BubbleSort:
import java.util.ArrayList;
import javax.swing.JOptionPane;
import java.io.FileWriter;
import java.io.IOException;
public class BubbleSort {
// Private instance variables:
private ArrayList<String> list;
private int number;
public BubbleSort(ArrayList<String> a_list) {
list = a_list;
}
public void swap(int first, int second) {
String temp1 = list.get(first);
String temp2 = list.get(second);
list.set(first, temp2);
list.set(second, temp1);
}
public int getNumber() {
String numStr;
numStr = JOptionPane.showInputDialog("How many names do you want to sort?");
number = Integer.parseInt(numStr);
return number;
}
public void printSorted() {
try {
FileWriter writer = new FileWriter("sorted.dat");
for (int i = 0; i < number; i++) {
writer.write(list.get(i) + "\n");
}
writer.close();
} catch (IOException exception) {
System.out.println("Error processing file: " + exception);
}
}
public void bubbleSort() {
for (int i = 0; i < number; i++) {
for (int j = 0; j < number - i - 1; j++) {
if (list.get(i).compareTo(list.get(i+1)) > 0) {
swap(i, i + 1);
}
}
}
} // End method
}
BubbleSortTimer:
import java.util.ArrayList;
import java.io.BufferedReader;
import java.io.FileReader;
import javax.swing.JOptionPane;
import java.io.IOException;
public class BubbleSortTimer {
private ArrayList<String> list = new ArrayList<String>();
public void readNames() {
try {
FileReader reader = new FileReader("BetelgeuseNames.dat");
BufferedReader in = new BufferedReader(reader);
boolean done = false;
String name;
while (done == false) {
name = in.readLine();
if (name == null) {
done = true;
} else {
list.add(name);
}
}
reader.close();
} catch (IOException exception) {
System.out.println("Error processing file: " + exception);
}
} // End method
public void runSort() {
readNames();
StopWatch timer = new StopWatch();
BubbleSort sorter = new BubbleSort(list);
int number = sorter.getNumber();
timer.start();
sorter.bubbleSort();
timer.stop();
sorter.printSorted();
String msg = "Number of names sorted: " + number + "\nMilliseconds required to sort: " + timer.getElapsedTime() + "\nOutput file is \"sorted.dat\"";
JOptionPane.showMessageDialog(null, msg);
}
public static void main(String[] args) {
BubbleSortTimer bubble = new BubbleSortTimer();
bubble.runSort();
}
}
StopWatch:
/**
* A stopwatch accumulates time when it is running. You can
* repeatedly start and stop the stopwatch. You can use a
* stopwatch to measure the running time of a program.
* from section 18.2 of Horstmann's CCJ
*/
public class StopWatch {
/**
* Constructs a stopwatch that is in the stopped state
* and has no time accumulated.
*/
public StopWatch() {
reset();
}
/**
* Starts the stopwatch. Times starts accumulating now.
*/
public void start() {
if (isRunning) return;
isRunning = true;
startTime = System.currentTimeMillis();
}
/**
* Stops the stopwatch. Time stops accumulating and is
* added to the elapsed time.
*/
public void stop() {
if (!isRunning) return;
isRunning = false;
long endTime = System.currentTimeMillis();
elapsedTime = elapsedTime + endTime - startTime;
}
/**
* Returns the total elapsed time.
#return the total elapsed time
*/
public long getElapsedTime() {
if (isRunning) {
long endTime = System.currentTimeMillis();
elapsedTime = elapsedTime + endTime - startTime;
startTime = endTime;
}
return elapsedTime;
}
/**
* Stops the watch and resets the elapsed time to 0.
*/
public void reset() {
elapsedTime = 0;
isRunning = false;
}
private long elapsedTime;
private long startTime;
private boolean isRunning;
}
Input:
Moewm
Bmlzvltcso
Aqxjor
Wwgjie
Qqqtpivd
Xgyhaerv
Wqpjwdvxjq
Ecsfnow
Zlptuqxctt
Jhtprwvopk
Expected Output:
Aqxjor
Bmlzvltcso
Ecsfnow
Jhtprwvopk
Moewm
Qqqtpivd
Wqpjwdvxjq
Wwgjie
Xgyhaerv
Zlptuqxctt
Actual Output:
Bmlzvltcso
Aqxjor
Moewm
Qqqtpivd
Wwgjie
Wqpjwdvxjq
Ecsfnow
Xgyhaerv
Jhtprwvopk
Zlptuqxctt

This is how Android did (binary) sorting (edited to fix this situation):
public void binarySort() {
int lo = 0; // sort start
for (int start=lo ; start < number; start++) {
String pivot = list.get(start);
// Set left (and right) to the index where list.get(start) (pivot) belongs
int left = 0;
int right = start;
assert left <= right;
/*
* Invariants:
* pivot >= all in [lo, left].
* pivot < all in [right, start].
*/
while (left < right) {
int mid = (left + right) >>> 1;
if (pivot.compareTo(list.get(mid)) < 0)
right = mid;
else
left = mid + 1;
}
assert left == right;
/*
* The invariants still hold: pivot >= all in [lo, left] and
* pivot < all in [left, start], so pivot belongs at left. Note
* that if there are elements equal to pivot, left points to the
* first slot after them -- that's why this sort is stable.
* Slide elements over to make room for pivot.
*/
int n = start - left; // The number of elements to move
// Switch is just reshifter in default case
switch (n) {
case 2: list.set(left + 2,list.get(left + 1));
case 1: list.set(left + 1,list.get(left));
break;
default:
if(n>0){
list.add(left,list.remove(left+n));
}
}
list.set(left,pivot);
}
}
This is how you can do (bubble) sorting:
public void bubbleSort() {
for (int i = 0; i < number; i++) {
for (int j = i + 1; j < number; j++) {
if (list.get(i).compareTo(list.get(j)) > 0) {
swap(i, j);
}
}
}
}
BUBBLE SORTING V/S BINARY SORTING:
OFF TOPIC: As you can compare above, bubble sorting is easier to code/read/understand and is also faster as compared to binary sorting, because binary sorting (actually) uses array recreation many times which ofcourse takes more time compared to swap.

Because there is a problem with your bubbleSort() method. Please try this way.
public void bubbleSort() {
for (int i = 0; i < number; i++) {
for (int j = 1; j < number - i; j++) {
if (list.get(j - 1).compareTo(list.get(j)) > 0) {
swap(j - 1, j);
}
}
}
}

java program is printing objects in the wrong order

I'm trying to write a class called RailwayStation that will print an array of train (using two different classes I wrote called TIME1and Train. My problem is that I can't understand why the output is arranged in the wrong order.
I assume the problem is in the method inside the class called addTrain, which supposed to add a train trip if there exists an empty cell in the array, and if the trip that wishes to be added does not exists already in the array. another method I used (and might be the problem) is called removeTrain, which receives a parameter of a train trip and removes that from the array. My methods addTrain, removerTrain, and toStringis as follows:
public class RailwayStation {
// declrations of final variables
private final int MAX_TRAINS = 100;
private final int MIN_VAL = 0;
// declrations of instant variables
private Train[] _station;
private int _noOfTrs;
/**
* Empty construter which initialize the instant variables of the class such that the trips array will be in a maximal size
*/
public RailwayStation() {
_station = new Train[MAX_TRAINS];
_noOfTrs = MIN_VAL;
}
/**
* adds a train trip to the trips array
*
* #param f the train trip
* #Returns true if a train trip has been added to the trips array
*/
public boolean addTrain(Train f) {
int i, j;
// boolean found = false;
if (isTrainOnSomeStation(f)) {
return false;
}
else {
for (j = MIN_VAL; j < _station.length; j++) {
if (_station[j] == null) {
_station[j] = f;
_noOfTrs++;
return true;
}
}
return false;
}
}
// a private method that checks if #param f is null
private boolean isTrainOnSomeStation(Train f) {
if (f == null) {
return false;
}
for (int i = MIN_VAL; i < _station.length; i++) {
if (_station[i] != null && _station[i].equals(f)) {
return true;
}
}
return false;
}
/**
* removes a trip from the trips array
* #param f the train trip
* #returns true if the train trip has been removed
*/
public boolean removeTrain(Train f) {
int i, j;
boolean found = false;
for (j = MIN_VAL; j < _station.length && !found; j++) {
if (_station[j] != null) {
for (i = MIN_VAL; i < _noOfTrs && !found; i++)
if (_station[i].equals(f)) {
_station[i] = _station[_noOfTrs];
_station[_noOfTrs] = null;
found = true;
_noOfTrs--;
}
}
}
return found;
}
/** Returns a string which describes all train in the array as apperas in the arrray
* #Returns a string of trains as appears in the arrat
*/
public String toString(){
String str = "The trains today are:" +"\n";
if(_noOfTrs == MIN_VAL){
return "There are no trains today.";
}
else {
String capacity = "";
for (int i = 0; i < _station.length; i++) {
if (_station[i] != null) {
if (_station[i].isFull() == true) {
capacity = "Train is full";
}
else {
capacity = "Train is not full";
}
str += _station[i].toString() + "\n";
}
}
}
return str;
}
}
In order to call the method addTrain I'll be writing:
//Check constructor
RailwayStation rs = new RailwayStation();
//AddTrain
Train f1 = new Train("Haifa",12,0,210,250,250,55);
Train f2 = new Train("Jerusalem",10,50,210,250,250,40);
rs.addTrain(f1);
rs.addTrain(f2);
System.out.println(rs);
//RemoveTrain
rs.removeTrain(f1);
System.out.println(rs);
//First Train to Destination
Train f3 = new Train("Tel-Aviv",11,35,180,100,200,35);
rs.addTrain(f3);
Train f3a = new Train("Tel-Aviv",7,15,180,200,200,35);
rs.addTrain(f3a);
I'm expecting to get the output:
The trains today are:
Train to Jerusalem departs at 10:50. Train is full.
Train to Tel-Aviv departs at 11:35. Train is not full.
Train to Tel-Aviv departs at 07:15. Train is full.
but what I get is:
The trains today are:
Train to Tel-Aviv departs at 11:35. Train is not full.
Train to Jerusalem departs at 10:50. Train is full.
Train to Tel-Aviv departs at 07:15. Train is full.
I've tried to use the debugger in order to understand in what part the order gets wrong, but I can't locate the problem.

When you add the first trains your array is like so:
Train[0] = Haifa...
Train[1] = Jerusalem..
Train[2] = null
Train[3] = null
...
Then you remove Haifa:
Train[0] = null
Train[1] = Jerusalem..
Train[2] = null
Train[3] = null
...
Then you add the other trains:
Train[0] = Tel Aviv..
Train[1] = Jerusalem..
Train[2] = Tel Aviv..
Train[3] = null
...
Does that explain it?
The data structure you're trying to build here is a Stack - but the good news is that java already has one, so no need to do what you are trying to do:
Stack<Train> trains = new Stack<>();
Train f1 = new Train("Haifa",12,0,210,250,250,55);
Train f2 = new Train("Jerusalem",10,50,210,250,250,40);
trains.push(f1);
trains.push(f2);
//RemoveTrain
trains.remove(f1);
//First Train to Destination
Train f3 = new Train("Tel-Aviv",11,35,180,100,200,35);
trains.push(f3);
Train f3a = new Train("Tel-Aviv",7,15,180,200,200,35);
trains.push(f3a);
String str = "The trains today are:" +"\n";
for(Train train: trains) {
str = str + train + "\n";
}
System.out.println(str);

My return values always equal 0

I coded multiple methods which use arrays to determine a certain value but they all result in 0 and I don't know why. The goal is to create a list of textbooks in a library and then return the heaviest book, weight, index, average page count and total page count.
public class Project3Driver {
// Data Fields
public static final int SUBJECTS = 5;
public static final int TEXTBOOKS = 10000;
String[] SUBJECT_LIST = {"Biology", "Calculus", "Linear Algebra", "Geology", "C++"};
Textbook[] library = new Textbook[TEXTBOOKS];
Random rand = new Random();
// Constructor that uses min-max system to randomize page count from 500-1500 and randomizes the subject
public Project3Driver() {
for (int i = 0; i < library.length; i++) {
library[i] = new Textbook(SUBJECT_LIST[rand.nextInt(SUBJECTS)], 500 + (int) (Math.random() * ((1500 - 500) + 1)));
}
}
// Methods
// Finds the heaviest book and returns the weight
public double findHeaviest() {
double heaviestBook = library[0].getWeight();
for (int i = 1; i < library.length; i++) {
if (library[i].getWeight() > heaviestBook) {
heaviestBook = library[i].getWeight();
}
}
return heaviestBook;
}
// Finds the heaviest book and returns the index
public int getHeaviest() {
double heaviestBook = library[0].getWeight();
int index = 0;
for (int i = 1; i < library.length; i++) {
if (library[i].getWeight() > heaviestBook)
{
heaviestBook = library[i].getWeight();
index = i;
}
}
return index;
}
// Returns the average page count of the library
public int computeAverageSize() {
int pageCount = 0;
for (int i = 0; i < library.length; i++)
{
pageCount = pageCount + library[i].getPageCount();
}
pageCount = pageCount / library.length;
return pageCount;
}
// Returns the total page count of the library
public int computeTotalPages()
{
int pageCount = 0;
for (int i = 0; i < library.length; i++)
{
pageCount = pageCount + library[i].getPageCount();
}
return pageCount;
}
// Tests each method and prints it (called in the main function)
public void getLibraryStats()
{
System.out.println("Heaviest book is " + library[getHeaviest()].getSubject());
System.out.println("The heaviest book is " + findHeaviest() + " kg");
System.out.println("The heaviest book is at the index " + getHeaviest());
System.out.println("The average book size is " + computeAverageSize());
System.out.println("There are " + computeTotalPages() + " pages total");
}
}
The getPageCount method simply returns the page count and getWeight returns the weight (by multiplying pageCount * 0.0025)
Any help would be greatly appreciated! I feel like it could be a problem with my arrays but I checked multiple times for errors
EDIT:
public class Textbook {
public static final double PAGE_WEIGHT = 0.0025;
public static final int PAGE_KNOWLEDGE = 5;
private String subject;
private int pageCount;
private int unreadPages;
// Start of Constructors
// Default constructor
public Textbook() {
subject = "Object-Oriented Programming";
pageCount = 800;
unreadPages = pageCount;
}
// Constructor with subject only
public Textbook(String textSubject) {
subject = textSubject;
}
// End subject constructor
// Constructor with subject and page count
public Textbook(String bookSubject, int bookPages) {
subject = bookSubject;
unreadPages = pageCount;
} // End subject and page count constructor
// End of Constructors
// Start of Accessor Methods
// Method to return text subject
public String getSubject() {
return subject;
}
// Method to return page count
public int getPageCount() {
return pageCount;
}
// Method to return unread pages
public int getUnreadPageCount() {
return unreadPages;
}
// Method to get weight
public double getWeight() {
return pageCount * PAGE_WEIGHT;
}
// Method to read the pages
public int readPages(int numPages) {
if (numPages > pageCount) {
numPages = pageCount;
}
int knowledgeGained = 0;
if (unreadPages == 0) {
knowledgeGained = numPages * 5 / 2;
} else if (unreadPages <= numPages) {
knowledgeGained = unreadPages * 5 + (numPages - unreadPages) * 5 / 2;
unreadPages = 0;
} else {
knowledgeGained = numPages * 5;
unreadPages -= numPages;
}
return knowledgeGained;
}
}
public class CSC211Project3
{
public static void main(String[] args)
{
Project3Driver librarytester = new Project3Driver();
librarytester.getLibraryStats();
}
}

Your Textbook constructor doesn't initialize pageCount, so it will default to 0.
To fix it, initialize the field:
public Textbook(String bookSubject, int bookPages) {
subject = bookSubject;
pageCount = bookPages;
unreadPages = bookPages;
}

Try using a system out statement in the for loop to debug or debug with breakpoints.
Debugging with system out,
System.out.println("getting formed book weight "+library[i].getWeight())
There might be something wrong in the logic of the Textbook class constructor

Java Homework Assignment Linked List

Thank you for everyone who got me on my feet. However, My cutSplice method is inefficient. I need to be able to modify it easy so that i can do the reverse method.
developing a single Java class (LinkedDnaStrand) that uses a linked list of nodes to represent a strand of DNA that supports splicing. Each node in the list will contain a string of one or more nucleotides (A, C, G, or T). The class will be responsible for operations such as append() and cutSplice(), which model real-world restriction enzyme processing.
EX. tt will be replaced with cat. (Better LinkedDnaStrandTester)
package dnasplicing;
public class DnaSequenceNode {
public String dnaSequence;
public DnaSequenceNode previous;
public DnaSequenceNode next;
public DnaSequenceNode(String initialDnaSequence) {
dnaSequence = initialDnaSequence;
}
}
package dnasplicing;
public class LinkedDnaStrand implements DnaStrand {
int nodeCount = 0;
int appendCount = 0;
long nucleotideCount = 0;
String sequenceString;
DnaSequenceNode cursor, head, tail;
public LinkedDnaStrand(String dnaSequence) {
DnaSequenceNode newNode = new DnaSequenceNode(dnaSequence);
head = newNode;
cursor = head;
tail = head;
head.previous = null;
tail.previous = null;
sequenceString = dnaSequence;
nodeCount++;
}
public String toString() {
String result = "";
DnaSequenceNode n = head;
while (n != null) {
result += n.dnaSequence;
n = n.next;
}
return result;
}
#Override
public long getNucleotideCount() {
nucleotideCount = sequenceString.length();
return nucleotideCount;
}
#Override
public void append(String dnaSequence) {
if (dnaSequence != null && dnaSequence.length() > 0) {
tail.next = new DnaSequenceNode(dnaSequence);
tail.next.previous = tail;
tail = tail.next;
sequenceString += dnaSequence;
appendCount++;
nodeCount++;
}
}
#Override
public DnaStrand cutSplice(String enzyme, String splicee) {
boolean frontSplice = false;
boolean backSplice = false;
if (sequenceString.startsWith(enzyme)) {
frontSplice = true;
}
if (sequenceString.endsWith(enzyme)) {
backSplice = true;
}
String[] dnaParts = sequenceString.split(enzyme);
LinkedDnaStrand newLinkedStrand = null;
if (frontSplice == true) {
newLinkedStrand = new LinkedDnaStrand(splicee);
// newLinkedStrand.append(dnaParts[0]);
for (int i = 1; i < dnaParts.length; i++) {
newLinkedStrand.append(dnaParts[i]);
if (i < dnaParts.length - 1) {
newLinkedStrand.append(splicee);
}
}
} else {
newLinkedStrand = new LinkedDnaStrand(dnaParts[0]);
for (int index = 1; index < dnaParts.length; index++) {
newLinkedStrand.append(splicee);
newLinkedStrand.append(dnaParts[index]);
}
}
if (backSplice == true) {
newLinkedStrand.append(splicee);
}
// sequenceString = newLinkedStrand.toString();
return newLinkedStrand;
}
#Override
public DnaStrand createReversedDnaStrand() {
// TODO Auto-generated method stub
return null;
}
#Override
public int getAppendCount() {
// TODO Auto-generated method stub
return appendCount;
}
#Override
public DnaSequenceNode getFirstNode() {
return head;
}
#Override
public int getNodeCount() {
return nodeCount;
}
}
package dnasplicing;
public interface DnaStrand {
/**
* NOTE: Your LinkedDnaStrand class must have a constructor that takes one parameter: String dnaSequence. When the
* constructor completes, your linked list should have just one node, and it should contain the passed-in
* dnaSequence. For example, if the following line of code was executed:
*
* LinkedDnaStrand strand = new LinkedDnaStrand("GATTACA");
*
* Then strand's linked list should look something like (previous pointers not shown):
*
* first -> "GATTACA" -> null
*
* The first line of this constructor should look like:
*
* public LinkedDnaStrand(String dnaSequence) {
*/
/**
* #return The entire DNA sequence represented by this DnaStrand.
*/
public String toString();
/**
* Returns the number of nucleotides in this strand.
*
* #return the number of base-pairs in this strand
*/
public long getNucleotideCount();
/**
* Appends the given dnaSequence on to the end of this DnaStrand. appendCount is incremented. Note: If this
* DnaStrand is empty, append() should just do the same thing as the constructor. In this special case, appendCount
* is not incremented.
*
* #param dnaSequence
* is the DNA string to append
*/
public void append(String dnaSequence);
/**
* This method creates a <bold>new</bold> DnaStrand that is a clone of the current DnaStrand, but with every
* instance of enzyme replaced by splicee. For example, if the LinkedDnaStrand is instantiated with "TTGATCC", and
* cutSplice("GAT", "TTAAGG") is called, then the linked list should become something like (previous pointers not
* shown):
*
* first -> "TT" -> "TTAAGG" -> "CC" -> null
*
* <b>NOTE</b>: This method will only be called when the linke list has just one node, and it will only be called
* once for a DnaStrand. This means that you do not need to worry about searching for enzyme matches across node
* boundaries.
*
* #param enzyme
* is the DNA sequence to search for in this DnaStrand.
*
* #param splicee
* is the DNA sequence to append in place of the enzyme in the returned DnaStrand
*
* #return A <bold>new</bold> strand leaving the original strand unchanged.
*/
public DnaStrand cutSplice(String enzyme, String splicee);
/**
* Returns a <bold>new</bold> DnaStrand that is the reverse of this strand, e.g., if this DnaStrand contains "CGAT",
* then the returned DnaStrand should contain "TAGC".
*
* #return A <bold>new</bold> strand containing a reversed DNA sequence.
*/
public DnaStrand createReversedDnaStrand();
/**
*
* #return The number of times that the DnaStrand has been appended via a call to append() or during the cutSplice()
* operation. Note that the very first time that a DnaStrand is given a DNA sequence is not to be counted as
* an append.
*/
public int getAppendCount();
/**
* This is a utility method that allows the outside world direct access to the nodes in the linked list.
*
* #return The first DnaSequenceNode in the linked list of nodes.
*/
public DnaSequenceNode getFirstNode();
/**
* This is a utility method that allows the outside world to determine the number of nodes in the linked list.
*
* #return
*/
public int getNodeCount();
}
package sbccunittest;
import static java.lang.Math.*;
import static java.lang.System.*;
import static org.apache.commons.lang3.StringUtils.*;
import static org.junit.Assert.*;
import java.io.*;
import org.apache.commons.lang3.*;
import org.junit.*;
import dnasplicing.*;
// Updated 25-Feb-2016 at 6:10pm
public class LinkedDnaStrandTester {
static String ecoliSmall = "AGCTTTTCATTAGCCCGCAGGCAGCCCCACACCCGCCGCCTCCTGCACCGAGAGAGATGGAATAAAGCCCTTGAACCAGC";
static String ecor1 = "GAATTC"; // restriction enzyme
public static int totalScore = 0;
public static int extraCredit = 0;
public static InputStream defaultSystemIn;
public static PrintStream defaultSystemOut;
public static PrintStream defaultSystemErr;
public static String newLine = System.getProperty("line.separator");
public void testCutSplice() {
String enzyme = "GAT";
String splicee = "TTAAGG";
String[] strands = { "TTGATCC", "TCGATCTGATTTCCGATCC", "GATCTGATCTGAT" };
String[][] recombinants = { { "TT", "TTAAGG", "CC" },
{ "TC", "TTAAGG", "CT", "TTAAGG", "TTCC", "TTAAGG", "CC" },
{ "TTAAGG", "CT", "TTAAGG", "CT", "TTAAGG" } };
for (int ndx = 0; ndx < strands.length; ndx++) {
LinkedDnaStrand linkedStrand = new LinkedDnaStrand(strands[ndx]);
DnaStrand newlinkedStrand = linkedStrand.cutSplice(enzyme, splicee);
assertEquals("cutSplice(" + enzyme + ", " + splicee + ") failed at ndx = " + ndx, join(recombinants[ndx]),
newlinkedStrand.toString());
assertEquals("Append counts didn't match for ndx = " + ndx, recombinants[ndx].length - 1,
newlinkedStrand.getAppendCount());
// Verify that each node contains the correct DNA sequence
DnaSequenceNode node = newlinkedStrand.getFirstNode();
for (int nodeNdx = 0; nodeNdx < recombinants.length; nodeNdx++) {
assertNotNull("For strand " + ndx + ", there is no node at position " + nodeNdx, node);
assertEquals("For strand " + ndx + ", the sequences don't match at position " + nodeNdx,
recombinants[ndx][nodeNdx], node.dnaSequence);
node = node.next;
}
}
totalScore += 5;
}
/**
* Verifies that LinkedDnaStrand can model a cut and splice of (part of) the E Coli sequence using the ECoR1
* restriction enzyme and insulin as a splicee.
*/
#Test
public void testSpliceInsulinIntoEcoli() {
for (int testNumber = 1; testNumber <= 5; testNumber++) {
int startNdx = (int) (random() * 0.33 * ecoliSmall.length()); // Somewhere in the
// first third
int endNdx = ecoliSmall.length() - 1 - (int) (random() * 0.33 * ecoliSmall.length());
String ecoliPart = ecoliSmall.substring(startNdx, endNdx);
LinkedDnaStrand linkedStrand = new LinkedDnaStrand(ecoliPart);
SimpleDnaStrand simpleStrand = new SimpleDnaStrand(ecoliPart);
DnaStrand newL = linkedStrand.cutSplice(ecor1, insulin);
DnaStrand newS = simpleStrand.cutSplice(ecor1, insulin);
assertEquals(newS.toString(), newL.toString());
assertEquals(newS.getAppendCount(), newL.getAppendCount());
assertEquals(newS.getAppendCount(), newL.getNodeCount() - 1);
// Verify that the nodes exist
DnaSequenceNode node = newL.getFirstNode();
for (int ndx = 0; ndx < newL.getNodeCount(); ndx++) {
assertNotNull("There is no node at position " + ndx, node);
node = node.next;
}
}
totalScore += 10;
}
/**
* Verifies that LinkedDnaStrand can model a cut and splice efficiently.
*/
#Test
public void testSplicingTime() {
// First verify that the LinkedDnaStrand cutSplice works
int startNdx = (int) (random() * 0.33 * ecoliSmall.length()); // Somewhere in the first
// third
int endNdx = ecoliSmall.length() - 1 - (int) (random() * 0.33 * ecoliSmall.length());
String ecoliPart = ecoliSmall.substring(startNdx, endNdx);
LinkedDnaStrand linkedStrand = new LinkedDnaStrand(ecoliPart);
SimpleDnaStrand simpleStrand = new SimpleDnaStrand(ecoliPart);
String splicee = createRandomDnaSequence(1024 * 1024, 1024 * 1024);
DnaStrand newL = linkedStrand.cutSplice(ecor1, splicee);
DnaStrand newS = simpleStrand.cutSplice(ecor1, splicee);
assertEquals(newS.toString(), newL.toString());
assertEquals(newS.getAppendCount(), newL.getAppendCount());
// Now verify that it can cut and splice N times in less than T seconds
int numSplicings = 200;
double maxTime = 2.0;
double start = nanoTime();
for (int i = 0; i < numSplicings; i++)
newL = linkedStrand.cutSplice(ecor1, splicee);
double end = nanoTime();
double time = ((end - start) / 1e9);
// out.println("Time = " + time);
assertTrue("Time limit of " + maxTime + " seconds exceeded. Time to splice " + numSplicings + " times was "
+ time + " seconds.", time <= maxTime);
totalScore += 5;
}
/**
* Verifies that LinkedDnaStrand can create a new, reversed LinkedDnaStrand.
*/
#Test
public void testReverse() {
String dnaSequence = createRandomDnaSequence(50, 100);
String dnaToAppend = createRandomDnaSequence(5, 10);
int numTimesToAppend = (int) (random() * 10);
LinkedDnaStrand linkedStrand = new LinkedDnaStrand(dnaSequence);
SimpleDnaStrand simpleStrand = new SimpleDnaStrand(dnaSequence);
for (int ndx = 0; ndx < numTimesToAppend; ndx++) {
linkedStrand.append(dnaToAppend);
simpleStrand.append(dnaToAppend);
}
assertEquals(simpleStrand.toString(), linkedStrand.toString());
assertEquals(numTimesToAppend + 1, linkedStrand.getNodeCount());
LinkedDnaStrand rl = (LinkedDnaStrand) linkedStrand.createReversedDnaStrand();
// Verify that the original linked strand wasn't changed
DnaSequenceNode node = linkedStrand.getFirstNode();
int nodeNdx = 0;
while (node != null) {
assertEquals("Sequences don't match at node index " + nodeNdx, nodeNdx == 0 ? dnaSequence : dnaToAppend,
node.dnaSequence);
node = node.next;
nodeNdx++;
}
// Verify that the new strand string is reversed
assertEquals(simpleStrand.createReversedDnaStrand().toString(), rl.toString());
totalScore += 10;
// If the new strand has a reverse order of nodes and sequences within each node, give extra
// credit
int numNodes = linkedStrand.getNodeCount();
if (numNodes == rl.getNodeCount()) {
// Build array of reversed dna strings from original LinkedDnaStrand. Start at end of
// array and move toward
// start
node = linkedStrand.getFirstNode();
String[] reversedDnaSequences = new String[linkedStrand.getNodeCount()];
nodeNdx = numNodes - 1;
while (node != null) {
reversedDnaSequences[nodeNdx] = reverse(node.dnaSequence);
node = node.next;
nodeNdx--;
}
// Verify that the reversed list's nodes contain the same data as in the array
node = rl.getFirstNode();
nodeNdx = 0;
while (node != null) {
if (!node.dnaSequence.equals(reversedDnaSequences[nodeNdx]))
break;
node = node.next;
nodeNdx++;
}
if (nodeNdx == linkedStrand.getNodeCount())
extraCredit += 5;
}
}
private String[] createRandomDnaSequences(int numDnaSequences, int minLength, int maxLength) {
String[] dnaSequences = new String[numDnaSequences];
for (int ndx = 0; ndx < numDnaSequences; ndx++)
dnaSequences[ndx] = createRandomDnaSequence(minLength, maxLength);
return dnaSequences;
}
private String createRandomDnaSequence(int minLength, int maxLength) {
return RandomStringUtils.random((int) (random() * (maxLength - minLength) + minLength), "ACGT");
}
#BeforeClass
public static void beforeTesting() throws Exception {
totalScore = 0;
extraCredit = 0;
}
#AfterClass
public static void afterTesting() {
out.println("Estimated score (w/o late penalties, etc.) = " + totalScore);
out.println("Estimated extra credit (assuming on time submission) = " + extraCredit);
}
#Before
public void setUp() throws Exception {
defaultSystemIn = System.in;
defaultSystemOut = System.out;
defaultSystemErr = System.err;
}
#After
public void tearDown() throws Exception {
System.setIn(defaultSystemIn);
System.setOut(defaultSystemOut);
System.setErr(defaultSystemErr);
}
public void sendToStdinOfTestee(String message) {
System.setIn(new ByteArrayInputStream(message.getBytes()));
}
}

So I don't have some of the classes like the node class you are using so I cannot write the actual code but i will give you some pseudo code.
public String toString(){
String result = "";
Node n = start;
while(n != null){
string += n.data;
}
return result;
}
public long getNucleotideCount() {
long result = 0;
Node n = start;
while(n != null){
result += n.data.length();
}
return result;
}
public void append(String dnaSequence) {
end.next = new Node(dnaSequence);
end = end.next;
appendCount++;
}
public DnaStrand cutSplice(String enzyme, String splice) {
// For this I think it would be best to assemble into string then use replace
Node n = start;
String result = "";
while(n != null){
result += n.data;
}
result = result.replace(enzyme, splice)
return new DnaStrand(result);
}
The reverse method would be similar to cutSplice. Assemble to string, manipulate, then return new strand. If you need more help LMK.

how to implement multithreaded Breadth-first search in java?

I've done the breadth-first search in a normal way.
now I'm trying to do it in a multithreaded way.
i have one queue which is shared between the threads.
i use synchronize(LockObject) when i remove a node from the queue ( FIFI queue )
so what I'm trying to do is that.
when i thread finds a solution all the other threads will stop immediately.

i assume you are traversing a tree for your BFS.
create a thread pool.
for each unexplored children in the node, retrieve a thread from the thread pool (perhaps using a Semaphore). mark the child node as 'explored' and explore the node's children in a BFS manner. when you have found a solution or done exploring all the nodes, release the semaphore.
^ i've never done this before so i might have missed out something.

Assuming you want to do this iteratively (see note at the bottom why there may be better closed solutions), this is not a great problem for exercising multi threading. The problem is that multithreading is great if you don't depend on previous results, but here you want the minimum amount of coins.
As you point out, a breadth first solution guarantees that once you reach the desired amount, you won't have any further solutions with less coins in a single threaded environment. However, in a multithreaded environment, once you start calculating a solution, you cannot guarantee that it will finish before some other solution. Let's imagine for the value 21: it can be a 20c coin and a 1c or four 5c coins and a 1c; if both are calculating simultaneously, you cannot guarantee that the first (and correct) solution will finish first. In practice, it is unlikely the situation will happen, but when you work with multithreading you want the solution to work in theory, because multithreads always fail in the demonstration, no matter if they should not have failed until the death heat of the universe.
Now you have 2 possible solutions: one is to introduce choke points at the beginning of each level; you don't start that level until the previous level is finished. The other is once you reach a solution continue doing all the calculations with a lower level than the current result (which means you cannot purge the others). Probably with all the synchronization needed you get better performance by going single threaded, but let's go on.
For the first solution, the natural form is to iterate increasing the level. You can use the solution provided by happymeal, with a Semaphore. An alternative is to use the new classes provided by java.
CoinSet getCoinSet(int desiredAmount) throws InterruptedException {
// Use whatever number of threads you prefer or another member of Executors.
final ExecutorService executor = Executors.newFixedThreadPool(10);
ResultContainer container = new ResultContainer();
container.getNext().add(new Producer(desiredAmount, new CoinSet(), container));
while (container.getResult() == null) {
executor.invokeAll(container.setNext(new Vector<Producer>()));
}
return container.getResult();
}
public class Producer implements Callable<CoinSet> {
private final int desiredAmount;
private final CoinSet data;
private final ResultContainer container;
public Producer(int desiredAmount, CoinSet data, ResultContainer container) {
this.desiredAmount = desiredAmount;
this.data = data;
this.container = container;
}
public CoinSet call() {
if (data.getSum() == desiredAmount) {
container.setResult(data);
return data;
} else {
Collection<CoinSet> nextSets = data.addCoins();
for (CoinSet nextSet : nextSets) {
container.getNext().add(new Producer(desiredAmount, nextSet, container));
}
return null;
}
}
}
// Probably it is better to split this class, but you then need to pass too many parameters
// The only really needed part is to create a wrapper around getNext, since invokeAll is
// undefined if you modify the list of tasks.
public class ResultContainer {
// I use Vector because it is synchronized.
private Vector<Producer> next = new Vector<Producer>();
private CoinSet result = null;
// Note I return the existing value.
public Vector<Producer> setNext(Vector<Producer> newValue) {
Vector<Producer> current = next;
next = newValue;
return current;
}
public Vector<Producer> getNext() {
return next;
}
public synchronized void setResult(CoinSet newValue) {
result = newValue;
}
public synchronized CoinSet getResult() {
return result;
}
}
This still has the problem that existing tasks are executed; however, it is simple to fix that; pass the thread executor into each Producer (or the container). Then, when you find a result, call executor.shutdownNow. The threads that are executing won't be interrupted, but the operation in each thread is trivial so it will finish fast; the runnables that have not started won't start.
The second option means you have to let all the current tasks finish, unless you keep track of how many tasks you have run at each level. You no longer need to keep track of the levels, though, and you don't need the while cycle. Instead, you just call
executor.submit(new Producer(new CoinSet(), desiredAmount, container)).get();
And then, the call method is pretty similar (assume you have executor in the Producer):
public CoinSet call() {
if (container.getResult() != null && data.getCount() < container.getResult().getCount()) {
if (data.getSum() == desiredAmount)) {
container.setResult(data);
return data;
} else {
Collection<CoinSet> nextSets = data.addCoins();
for (CoinSet nextSet : nextSets) {
executor.submit(new Producer(desiredAmount, nextSet, container));
}
return null;
}
}
}
and you also have to modify container.setResult, since you cannot depend that between the if and setting the value it has not been set by some other threads (threads are really annoying, aren't they?)
public synchronized void setResult(CoinSet newValue) {
if (newValue.getCount() < result.getCount()) {
result = newValue;
}
}
In all previous answers, CoinSet.getSum() returns the sum of the coins in the set, CoinSet.getCount() returns the number of coins, and CoinSet.addCoins() returns a Collection of CoinSet in which each element is the current CoinSet plus one coin of each possible different value
Note: For the problem of the coins with the values 1, 5, 10 and 20, the simplest solution is take the amount and divide it by the largest coin. Then take the modulus of that and use the next largest value and so on. That is the minimum amount of coins you are going to need. This rule applies (AFAICT) when the following property if true: if for all consecutive pairs of coin values (i.e. in this case, 1-5, 5-10, 10-20) you can reach any int multiple of the lower element in the pair with with a smaller number of coins using the larger element and whatever coins are necessary. You only need to prove it to the min common multiple of both elements in the pair (after that it repeats itself)

I gather from your comment on happymeal's anwer that you are trying to find how to reach a specific amount of money by adding coins of 1c, 5c, 10c and 20c.
Since each coin denomination divides the denomination of the next bigger coin, this can be solved in constant time as follows:
int[] coinCount(int amount) {
int[] coinValue = {20, 10, 5, 1};
int[] coinCount = new int[coinValue.length];
for (int i = 0; i < coinValue.length; i++) {
coinCount[i] = amount / coinValue[i];
amount -= coinCount[i] * coinValue[i];
}
return coinCount;
}
Take home message: Try to optimize your algorithm before resorting to multithreading, because algorithmic improvements can yield much greater improvements.

I've successfully implemented it.
what i did is that i took all the nodes in the first level, let's say 4 nodes.
then i had 2 threads. each one takes 2 nodes and generate their children. whenever a node finds a solution it has to report the level that it found the solution in and limit the searching level so other threads don't exceed the level.
only the reporting method should be synchronized.
i did the code for the coins change problem. this is my code for others to use
Main Class (CoinsProblemBFS.java)
package coinsproblembfs;
import java.util.ArrayList;
import java.util.LinkedList;
import java.util.List;
import java.util.Queue;
import java.util.Scanner;
/**
*
* #author Kassem M. Bagher
*/
public class CoinsProblemBFS
{
private static List<Item> MoneyList = new ArrayList<Item>();
private static Queue<Item> q = new LinkedList<Item>();
private static LinkedList<Item> tmpQ;
public static Object lockLevelLimitation = new Object();
public static int searchLevelLimit = 1000;
public static Item lastFoundNode = null;
private static int numberOfThreads = 2;
private static void InitializeQueu(Item Root)
{
for (int x = 0; x < MoneyList.size(); x++)
{
Item t = new Item();
t.value = MoneyList.get(x).value;
t.Totalvalue = MoneyList.get(x).Totalvalue;
t.Title = MoneyList.get(x).Title;
t.parent = Root;
t.level = 1;
q.add(t);
}
}
private static int[] calculateQueueLimit(int numberOfItems, int numberOfThreads)
{
int total = 0;
int[] queueLimit = new int[numberOfThreads];
for (int x = 0; x < numberOfItems; x++)
{
if (total < numberOfItems)
{
queueLimit[x % numberOfThreads] += 1;
total++;
}
else
{
break;
}
}
return queueLimit;
}
private static void initializeMoneyList(int numberOfItems, Item Root)
{
for (int x = 0; x < numberOfItems; x++)
{
Scanner input = new Scanner(System.in);
Item t = new Item();
System.out.print("Enter the Title and Value for item " + (x + 1) + ": ");
String tmp = input.nextLine();
t.Title = tmp.split(" ")[0];
t.value = Double.parseDouble(tmp.split(" ")[1]);
t.Totalvalue = t.value;
t.parent = Root;
MoneyList.add(t);
}
}
private static void printPath(Item item)
{
System.out.println("\nSolution Found in Thread:" + item.winnerThreadName + "\nExecution Time: " + item.searchTime + " ms, " + (item.searchTime / 1000) + " s");
while (item != null)
{
for (Item listItem : MoneyList)
{
if (listItem.Title.equals(item.Title))
{
listItem.counter++;
}
}
item = item.parent;
}
for (Item listItem : MoneyList)
{
System.out.println(listItem.Title + " x " + listItem.counter);
}
}
public static void main(String[] args) throws InterruptedException
{
Item Root = new Item();
Root.Title = "Root Node";
Scanner input = new Scanner(System.in);
System.out.print("Number of Items: ");
int numberOfItems = input.nextInt();
input.nextLine();
initializeMoneyList(numberOfItems, Root);
System.out.print("Enter the Amount of Money: ");
double searchValue = input.nextDouble();
int searchLimit = (int) Math.ceil((searchValue / MoneyList.get(MoneyList.size() - 1).value));
System.out.print("Number of Threads (Muste be less than the number of items): ");
numberOfThreads = input.nextInt();
if (numberOfThreads > numberOfItems)
{
System.exit(1);
}
InitializeQueu(Root);
int[] queueLimit = calculateQueueLimit(numberOfItems, numberOfThreads);
List<Thread> threadList = new ArrayList<Thread>();
for (int x = 0; x < numberOfThreads; x++)
{
tmpQ = new LinkedList<Item>();
for (int y = 0; y < queueLimit[x]; y++)
{
tmpQ.add(q.remove());
}
BFS tmpThreadObject = new BFS(MoneyList, searchValue, tmpQ);
Thread t = new Thread(tmpThreadObject);
t.setName((x + 1) + "");
threadList.add(t);
}
for (Thread t : threadList)
{
t.start();
}
boolean finish = false;
while (!finish)
{
Thread.sleep(250);
for (Thread t : threadList)
{
if (t.isAlive())
{
finish = false;
break;
}
else
{
finish = true;
}
}
}
printPath(lastFoundNode);
}
}
Item Class (Item.java)
package coinsproblembfs;
/**
*
* #author Kassem
*/
public class Item
{
String Title = "";
double value = 0;
int level = 0;
double Totalvalue = 0;
int counter = 0;
Item parent = null;
long searchTime = 0;
String winnerThreadName="";
}
Threads Class (BFS.java)
package coinsproblembfs;
import java.util.ArrayList;
import java.util.LinkedList;
import java.util.List;
/**
*
* #author Kassem M. Bagher
*/
public class BFS implements Runnable
{
private LinkedList<Item> q;
private List<Item> MoneyList;
private double searchValue = 0;
private long start = 0, end = 0;
public BFS(List<Item> monyList, double searchValue, LinkedList<Item> queue)
{
q = new LinkedList<Item>();
MoneyList = new ArrayList<Item>();
this.searchValue = searchValue;
for (int x = 0; x < queue.size(); x++)
{
q.addLast(queue.get(x));
}
for (int x = 0; x < monyList.size(); x++)
{
MoneyList.add(monyList.get(x));
}
}
private synchronized void printPath(Item item)
{
while (item != null)
{
for (Item listItem : MoneyList)
{
if (listItem.Title.equals(item.Title))
{
listItem.counter++;
}
}
item = item.parent;
}
for (Item listItem : MoneyList)
{
System.out.println(listItem.Title + " x " + listItem.counter);
}
}
private void addChildren(Item node, LinkedList<Item> q, boolean initialized)
{
for (int x = 0; x < MoneyList.size(); x++)
{
Item t = new Item();
t.value = MoneyList.get(x).value;
if (initialized)
{
t.Totalvalue = 0;
t.level = 0;
}
else
{
t.parent = node;
t.Totalvalue = MoneyList.get(x).Totalvalue;
if (t.parent == null)
{
t.level = 0;
}
else
{
t.level = t.parent.level + 1;
}
}
t.Title = MoneyList.get(x).Title;
q.addLast(t);
}
}
#Override
public void run()
{
start = System.currentTimeMillis();
try
{
while (!q.isEmpty())
{
Item node = null;
node = (Item) q.removeFirst();
node.Totalvalue = node.value + node.parent.Totalvalue;
if (node.level < CoinsProblemBFS.searchLevelLimit)
{
if (node.Totalvalue == searchValue)
{
synchronized (CoinsProblemBFS.lockLevelLimitation)
{
CoinsProblemBFS.searchLevelLimit = node.level;
CoinsProblemBFS.lastFoundNode = node;
end = System.currentTimeMillis();
CoinsProblemBFS.lastFoundNode.searchTime = (end - start);
CoinsProblemBFS.lastFoundNode.winnerThreadName=Thread.currentThread().getName();
}
}
else
{
if (node.level + 1 < CoinsProblemBFS.searchLevelLimit)
{
addChildren(node, q, false);
}
}
}
}
} catch (Exception e)
{
e.printStackTrace();
}
}
}
Sample Input:
Number of Items: 4
Enter the Title and Value for item 1: one 1
Enter the Title and Value for item 2: five 5
Enter the Title and Value for item 3: ten 10
Enter the Title and Value for item 4: twenty 20
Enter the Amount of Money: 150
Number of Threads (Muste be less than the number of items): 2