i am trying to run a batch file from my java code
this is the batch file line :
C:\Users\abdelk\workspace\Symmetrix>symconfigure -sid 13 -cmd "create dev count=16, size=139840, emulation=FBA , config=TDEV;" commit -nop >> out_file.txt
when i run the batch file from my code, "1" randomly appears before the ">>". so line in cmd becomes like that :
C:\Users\abdelk\workspace\Symmetrix>symconfigure -sid 13 -cmd "create dev count=16, size=139840, emulation=FBA , config=TDEV;" commit -nop **1>>** outfile.txt
I don't know how can i remove this random appearing "1"
this is how i run the batch file from my code
rt.exec("cmd.exe /c start "+functions_object.edit_host_name(current_host_name)+"_Meta.bat",null,new File("C:\\Users\\abdelk\\workspace\\Project"));
First, take a look on Microsoft's TechNet article using command redirection operators.
Numeric 1 is an equivalent for handle stdout (standard output).
In batch files numeric 1 is omitted on redirection stdout.
For example put those 2 lines into a batch file and run it
echo This is just a redirect test.>CapturedStandardOutput.txt
#pause
You will see that cmd.exe automatically inserts 1 (space and 1) left to the redirection operator >.
In general it is not advisable to add already in batch file 1 for stdout.
Why?
Look what is executed with:
echo This is just a redirect test.1>CapturedStandardOutput.txt
#pause
You see in console window:
echo This is just a redirect test.1 1>CapturedStandardOutput.txt
And the file CapturedStandardOutput.txt contains the line:
This is just a redirect test.1
The solution is to use in batch file:
echo This is just a redirect test. 1>CapturedStandardOutput.txt
This results in execution of the line:
echo This is just a redirect test. 1>CapturedStandardOutput.txt
And there is now the line below in file CapturedStandardOutput.txt:
This is just a redirect test.
What you can't see here in the browser window is that the line in the text file ends now with a trailing space in comparison to first example. Therefore best is to use > and >> always without 1 as otherwise it is not really simple to control what is written to the text file.
One more hint:
To redirect a text to a file which ends with 1, 2, ..., 9 it is necessary to escape the number with ^.
Execution of a batch file with
echo Number is ^1>CapturedStandardOutput.txt
#pause
results in executing the command line
echo Number is 1 1>CapturedStandardOutput.txt
and in file CapturedStandardOutput.txt the line
Number is 1
with no trailing space at end of the line.
0 left to > and >> must not be escaped to get number 0 written into a text file.
Related
I am trying to use the program Trimmomatic to removed adapter sequences from an Illumina paired-end read over a computer cluster. While I can get the program to open, it will either not acknowledge the commands I enter or will return an error message. I have tried all kinds of permutations of the input commands without success. Examples of input code and error messages are below
Code:
java -classpath /*filepath*/Trimmomatic-0.32/trimmomatic-0.32.jar org.usadellab.trimmomatic.TrimmomaticPE \
-phred33 -trimlog /Results/log.txt \
~/*filepath*/data_R1.fq ~/*filepath*/data_R2.fq \
ILLUMINACLIP:/*filepath*/Trimmomatic-0.32/adapters/TruSeq3-PE-2.fa:2:30:10:3:"true"
Results: (the o/s seems to find and execute the software, but is not feeding in the command; I get the same result if I use the java -jar option for executing Trimmomatic)
TrimmomaticPE [-threads <threads>] [-phred33|-phred64] [-trimlog <trimLogFile>] [-basein <inputBase> | <inputFile1> <inputFile2>] [-baseout <outputBase> | <outputFile1P> <outputFile1U> <outputFile2P> <outputFile2U>] <trimmer1>...
Code: (If I add in the command PE immediately before all other commands, the program executes and can find the fasta file containing the adapter sequences, but then searches for and cannot fund a file called 'PE')
java -classpath /*filepath*/trimmomatic-0.32.jar org.usadellab.trimmomatic.TrimmomaticPE \
PE -phred33 -trimlog /Results/log.txt \
~/*filepath*/data_R1.fq ~/*filepath*/data_R2.fq \
ILLUMINACLIP:/*filepath*/Trimmomatic-0.32/adapters/TruSeq3-PE-2.fa:2:30:10:3:"true"
Results: (Programs rus and finds the fasta file of adapter sequences, but then fails to execute. Why is it looking for a PE file?)
TrimmomaticPE: Started with arguments: PE -phred33 -trimlog /Results/log.txt /*filepath*/data_R1.fq /*filepath*/data_R2.fq ILLUMINACLIP:/*filepath*/Trimmomatic-0.32/adapters/TruSeq3-PE-2.fa:2:30:10:3:true
Multiple cores found: Using 12 threads
Using PrefixPair: 'TACACTCTTTCCCTACACGACGCTCTTCCGATCT' and 'GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT'
Using Long Clipping Sequence: 'AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC'
Using Long Clipping Sequence: 'TACACTCTTTCCCTACACGACGCTCTTCCGATCT'
Using Long Clipping Sequence: 'GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT'
Using Long Clipping Sequence: 'AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA'
ILLUMINACLIP: Using 1 prefix pairs, 4 forward/reverse sequences, 0 forward only sequences, 0 reverse only sequences
Exception in thread "main" java.io.FileNotFoundException: PE (No such file or directory)
at java.io.FileInputStream.open(Native Method)
at java.io.FileInputStream.<init>(FileInputStream.java:146)
at org.usadellab.trimmomatic.fastq.FastqParser.parse(FastqParser.java:127)
at org.usadellab.trimmomatic.TrimmomaticPE.process(TrimmomaticPE.java:251)
at org.usadellab.trimmomatic.TrimmomaticPE.run(TrimmomaticPE.java:498)
at org.usadellab.trimmomatic.TrimmomaticPE.main(TrimmomaticPE.java:506)
I've never used trimmomatic but it looks like you are passing in the incorrect parameters.
the trimmomatic webpage lists the usage from version 0.27+ as:
java -jar <path to trimmomatic.jar> PE [-threads <threads] [-phred33 | -phred64] [-trimlog <logFile>] <input 1> <input 2> <paired output 1> <unpaired output 1> <paired output 2> <unpaired output 2> <step 1> ...
or using the "old way"
java -classpath <path to trimmomatic jar> org.usadellab.trimmomatic.TrimmomaticPE [-threads <threads>] [-phred33 | -phred64] [-trimlog <logFile>] <input 1> <input 2> <paired output 1> <unpaired output 1> <paired output 2> <unpaired output 2> <step 1> ...
Where the only difference is the new way is specifying "PE" as the main class instead of a fully qualified path.
First, addressing your 2nd problem:
You look like you are doing both: specifying a fully qualified class name as well as the PE part. This makes trimmomatic think you have a fastq file named "PE" which doesn't exist.
If you get rid of the "PE" OR the qualfited class name; it will call the correct class. Which is what you do first in your first problem.
1st problem
I don't think you have the correct number of arguments listed in your first invocation so trimmomatic displays the usage to tell you what parameters are required. It would be nice if it told you what was wrong but it doesn't.
Solution
It looks like you are only providing 2 fastq files but trimmmoatic needs 6 file paths. You are missing the output paired and unpaired files paths for the read 1 and read 2 data which I assume get created by the program when it runs.
I guess your 2nd attempt got further along in the program since it saw enough parameters that you potentially had enough file paths specified (however, it turns out you had optional step parameters)
Following the advice of dkatzel below and user blakeoft on SeqAnswers (http://seqanswers.com/forums/showthread.php?t=45094), I dropped the PE flag and added individual file names for each output file and the program executed properly.
java -classpath /*filepath*/Trimmomatic-0.32/trimmomatic-0.32.jar org.usadellab.trimmomatic.TrimmomaticPE \
-phred33 \
~/refs/lec12/data_R1.fq ~/refs/lec12/data_R2.fq \
lane1_forward_paired.fq lane1_forward_unpaired.fq lane1_reverse_paired.fq lane1_reverse_unpaired.fq \
ILLUMINACLIP:/*filepath*/Trimmomatic-0.32/adapters/TruSeq3-PE-2.fa:2:30:10:3:true
NB: I also tried using the -baseout flag rather than a list of four files, and the program would open but not execute any commands
NB: The a log file could be generated using the flag -trimlog filename, but only if I first made a blank text file with the same name as the intended log file.
Are there any grep -like Unix/Linux command line tools that understand Java stacktraces in log files that are printed by log4j or logback? The tool should understand that a stacktrace consists of several lines.
Typical use case would be to filter out certain exceptions and corresponding stacktraces when viewing logs that are stored to files.
I'm using following sed one line program:
sed -nr ':main; /^[0-9 :,-]{23} ERROR / { :loop; p; n; /^[0-9 :,-]{23} / b main; b loop}'
The first [0-9 :,-]{23} recognizes log record start. Right after it, before the slash, you can write additional regexp to limit which records to print. The expression in {...} loops through the following lines until new record header is found.
My program works for logs where log records start with:
2015-08-25 12:49:34,906 ...
And prints all records with stack traces which has ERROR after record start. Example:
2015-08-25 12:49:34,906 ERROR [http-8080-89] [Error#112] NullPointerException:
at org.springframework.aop.support.AopUtils.invokeJoinpointUsingReflection(AopUtils.java:317)
at org.springframework.aop.framework.ReflectiveMethodInvocation.invokeJoinpoint(ReflectiveMethodInvocation.java:183)
at org.springframework.aop.framework.ReflectiveMethodInvocation.proceed(ReflectiveMethodInvocation.java:150)
...
The sed program explanation
The sed program expression /regexp/ command means: if the current line matches the regexp run command.
sed will read the input line and run the program. When the line matches /^[0-9 :,-]{23} ERROR / it runs the command block {...}, if not then since program ended, sed will not print the current line to output (option -n), then sed reads the next line and run the program again. This repeats until end of input.
{...} explanation:
p - print the current line
n - read next line
/^[0-9 :,-]{23} / b main - if the line matches the regexp continue at label :main - effectively rerunning the whole program on the current line without reading next line - to not miss next possible exception
continue at label :loop
So the regexps:
/^[0-9 :,-]{23} ERROR / matches lines which starts the log record
/^[0-9 :,-]{23} / matches line which is next log record
I don't know if this answers your question but when I want to get the stacktrace I use grep -A to get the lines right after the line I'm looking for.
For example:
grep -A 200 "2014-09-08/12:11:36.110" catalina.out
I am working on a application which first require to check the available free disk space before running any operation. We have set some Default required Space limit like 512MB, So if any working drive does not have more then 512mb space my program will prompt for less memory space available, please make sufficient space to run the program.
I am using following code for it.
long freeSpace = FileSystemUtils.freeSpaceKb() * 1024;
here I am coverting size into byte first to compare with our standard required size.
Due to the above statement i am gettign following exception:
Error-Command line returned OS error code '3' for command [cmd.exe, /C, dir /-c "F:\MyApp\"]Stacktrace java.io.IOException: Command line returned OS error code '3' for command [cmd.exe, /C, dir /-c "F:\MyApp"]
at org.apache.commons.io.FileSystemUtils.performCommand(FileSystemUtils.java:506)
at org.apache.commons.io.FileSystemUtils.freeSpaceWindows(FileSystemUtils.java:303)
at org.apache.commons.io.FileSystemUtils.freeSpaceOS(FileSystemUtils.java:270)
at org.apache.commons.io.FileSystemUtils.freeSpaceKb(FileSystemUtils.java:206)
at org.apache.commons.io.FileSystemUtils.freeSpaceKb(FileSystemUtils.java:240)
at org.apache.commons.io.FileSystemUtils.freeSpaceKb(FileSystemUtils.java:222)...
The OS returned Error Code is '3' thats mean it is not normal termination.
So now how can I resolve this issue ?
I also found alternative method available in java 1.6 - How to find how much disk space is left using Java?
new File("c:\\").getFreeSpace();
---------------------------------
**More Details :**
---------------------------------
OS Architecture : amd64
Temp Dir : c:\temp\
OS Name : Windows 7
OS Version : 6.1 amd64
Jre Version : 1.6.0_45-b06
User Home : C:\Users\Tej.Kiran
User Language : en
User Country: US
File Separator : \
Current Working Directory : F:\MyApp\
You can try executing that command from a prompt. Run cmd.exe and enter the following:
cmd.exe /C dir /-c "F:\MyApp\"
echo %errorlevel%
Error code 3 means the path doesn't exist, but in this case I wonder if it is related to permissions. Any non-zero errorlevel is a problem. If your Java app needs to know the free space on the drive it is installed on, you can do something like this:
// returns something like "file:/C:/MyApp/my/pkg/MyClass.class"
// -OR- "jar:file:/C:/MyApp/myjar.jar!/my/pkg/MyClass.class"
String myPath = my.pkg.MyClass.class.getResource(MyClass.class).toString();
int start = myPath.indexOf("file:/") + 6;
FileSystemUtils.freeSpaceKb(myPath.substring(start, myPath.indexOf("/", start));
Obviously this code wouldn't work in an applet, but that shouldn't be surprising. The substring logic should also be more robust, but this is just a simple example.
I have to execute a java code using batch script where java code has to take a variable value generated from the .bat file and execute java code and then return the another variable value back to .bat .
In say, exec.bat file i l get a value "456" .this "456" has to be sent to java file and there after execution we get another value "789" .And I want this "789" to be return back to exe.bat .
Please let me know the code and syntax to be written in both java and batch file.
Thanks in Advance
Here is one way to do it:
In Java code :
At the end of the program put this line
System.exit(789);
Here 789 is the value you would return to your batch file.
In the batch file:
#echo off
java Test %1
set exitcode=%ERRORLEVEL%
echo %exitcode%
Here
java Test %1 is the usual java execution with argument passed from batch file where %1 will map to the first parameter passed to the batch file from command prompt (like wise you could have %2 etc ... Check this article ).
ERRORLEVEL is the standard batch variable use to store the value returned from java
Assuming that your batch file name is Test.bat, you run this from command prompt batch as
Test 456
EDIT:Example for adding two numbers
Example.java
public class Example extends TestBase<String>
{
public static void main(String[] arg){
int result = Integer.parseInt(arg[0].trim()) ;+Integer.parseInt(arg[1].trim())
System.exit(result);
}
}
Compile this file and generate a class file Example.class
Batch file :
Example.bat
#echo off
java Example %1 %2
set exitcode=%ERRORLEVEL%
echo %exitcode%
Put this batch file and Example.class in a folder. Open command prompt from that folder and run as follows
Example 111 222
This will print the addition of these two numbers
I need to run an .sh file and get its output. I need to see the setup of the file as well.
The .sh file simply runs a java app through terminal.
Any ideas? I'm truly stuck on this.....
Elijah
The server.sh file:
echo Starting Jarvis Program D.
ALICE_HOME=.
SERVLET_LIB=lib/servlet.jar
ALICE_LIB=lib/aliceserver.jar
JS_LIB=lib/js.jar
# Set SQL_LIB to the location of your database driver.
SQL_LIB=lib/mysql_comp.jar
# These are for Jetty; you will want to change these if you are using a different http server.
HTTP_SERVER_LIBS=lib/org.mortbay.jetty.jar
PROGRAMD_CLASSPATH=$SERVLET_LIB:$ALICE_LIB:$JS_LIB:$SQL_LIB:$HTTP_SERVER_LIBS
java -classpath $PROGRAMD_CLASSPATH -Xms64m -Xmx128m org.alicebot.server.net.AliceServer $1
My current code:
NSTask *server = [NSTask new];
[server setLaunchPath:#"/bin/sh"];
[server setArguments:[NSArray arrayWithObject:#"/applications/jarvis/brain/server.sh"]];
NSPipe *outputPipe = [NSPipe pipe];
[server setStandardInput:[NSPipe pipe]];
[server setStandardOutput:outputPipe];
[server launch];
NSMutableString *outputString = [NSMutableString string];
while ([outputString rangeOfString:#"Jarvis>"].location == NSNotFound) {
[outputString appendString:[[[NSString alloc] initWithData:[[outputPipe fileHandleForReading] readDataToEndOfFile] encoding:NSUTF8StringEncoding] autorelease]];
NSRunAlertPanel(#"", outputString, #"", #"", #"");
}
The NSRunAlertPanel is just for checking the output. Now my code is freezing and not even getting to the alertpanel.
See answer to this question.
There are a couple of things that should be fixed in your script:
The script should begin with a
shebang. Also make sure that the
script has its executable bit set.
Because the environment variables are set up relative to the shell script directory, you need to make sure that the script directory is the current directory.
You need to export the environment variables that should be visible to the Java process.
In the last line you can use exec to replace the shell process with the Java executable that runs Jetty.
Here is a revised version of your script:
#!/bin/sh
echo Starting Jarvis Program D.
cd "`dirname \"$0\"`"
export ALICE_HOME=.
export SERVLET_LIB=lib/servlet.jar
export ALICE_LIB=lib/aliceserver.jar
export JS_LIB=lib/js.jar
# Set SQL_LIB to the location of your database driver.
export SQL_LIB=lib/mysql_comp.jar
# These are for Jetty; you will want to change these if you are using a different http server.
export HTTP_SERVER_LIBS=lib/org.mortbay.jetty.jar
export PROGRAMD_CLASSPATH=$SERVLET_LIB:$ALICE_LIB:$JS_LIB:$SQL_LIB:$HTTP_SERVER_LIBS
exec java -classpath $PROGRAMD_CLASSPATH -Xms64m -Xmx128m org.alicebot.server.net.AliceServer $1
Invoking the shell script in Objective-C with multiple arguments:
NSTask *server = [NSTask new];
[server setLaunchPath:#"/bin/sh"];
[server setArguments:[NSArray arrayWithObjects:#"/applications/jarvis/brain/server.sh", #"argument", nil]];
...
Using AMShellWrapperTest.app you can filter (save, ...) the stdout stream of server.sh by modifying "- (void)appendOutput:(NSString *)output" in BannerController.m. (... but maybe there is a better way to do this ...)
/*
// output from stdout
- modified AMShellWrapper/AMShellWrapperTest/BannerController.m (http://www.harmless.de/cocoa-code.php)
to print server.sh setup information to "Error Messages:" text output field (or Console.app as an
alternative) and the Q & A dialog to the "Output:" text field
- use of default charliebot, http://sourceforge.net/projects/charliebot/, modified only to run server.sh
with complete path (here: ~/Desktop/charliebot/server.sh) in AMShellWrapperTest.app
*/
- (void)appendOutput:(NSString *)output
{
NSMutableString *outputString = [NSMutableString string];
if (
([output rangeOfString:#"Charlie>"].location != NSNotFound ) || \
([output rangeOfString:#"[Charlie] user>"].location != NSNotFound )
) {
[self write: output];
[self write: #"\n"];
} else {
[outputString appendString: output];
//[outputString writeToFile:#"/dev/console" atomically: NO]; // alternative
[errorOutlet setString:[[errorOutlet string] stringByAppendingString: outputString]];
}
}
yes, but why isn't my code (posted above) not working?
I guess your "Jarvis>" line is the first line of the server.sh ouput stream that expects some user input, which means that this line is incomplete without a terminating newline character "\n". If server.sh had been run in Terminal.app, the user would have to press the return key to let the dialog continue. The conditional code of the while loop (NSNotFound) cannot finish its job on this incomplete line (which would be to abort the while loop) and gets stuck.
You have to drop the while loop and use the 'readInBackgroundAndNotify' mode on NSFileHandle to get non-blocking I/O stdout stream behaviour!
See: NSTask/NSPipe STDIN hangs on large data, sometimes...
So, if you like, just transform the source code of AMShellWrapperTest.app into a pure command-line tool by removing the GUI code.