We Keep Coding

Trying to replace a symbol in a text file of 4000 lines, ends up with only 500 in Java

What i'm trying to do, is to replace a symbol in a file text which contains over 4000 lines but using the below code, after the program ends, it only remain 500 lines. Why is this file truncated? How to solve this?
This is my code:
ArrayList<String> arrayList = new ArrayList<>();
try (FileReader fileReader = new FileReader(file);
BufferedReader bufferedReader = new BufferedReader(fileReader)) {
String line;
while ((line = bufferedReader.readLine()) != null) {
line = line.replace("þ", "t");
arrayList.add(line);
try (BufferedWriter bw = new BufferedWriter(new FileWriter(file))) {
for (String string : arrayList) {
bw.write(string + "\n");
}
} catch (Exception e) {System.err.println(e);}
}
} catch (Exception e) {e.printStackTrace();}
Thanks in advance!

new BufferedWriter(new FileWriter(file)) clear file.
You should open it only once. Also you reading and writing to the same file. You should use different files.
Like this
try (FileReader fileReader = new FileReader(inputFile);
BufferedReader bufferedReader = new BufferedReader(fileReader);
BufferedWriter bw = new BufferedWriter(new FileWriter(outputFile))) {
String line;
while ((line = bufferedReader.readLine()) != null) {
line = line.replace("þ", "t");
bw.write(line + "\n");
}
} catch (Exception e) {
e.printStackTrace();
}

You are writing to the same file while you are reading it. This won't work. Once you start writing, the file becomes empty (plus whatever you've written), so subsequent reads will report end-of-file. Your ~500 lines will be buffered input from the first read.
One solution is to do all the reading first, before opening the file again for writing:
Array<String> arrayList = new ArrayList<>();
try (BufferedReader bufferedReader = new BufferedReader(new FileReader(file))) {
while ((String line = bufferedReader.readLine()) != null) {
line = line.replace("þ", "t");
arrayList.add(line);
}
} catch (Exception e) {
e.printStackTrace();
}
try (BufferedWriter bw = new BufferedWriter(new FileWriter(file))) {
for (String string : arrayList) {
bw.write(string + "\n");
}
} catch (Exception e) {
System.err.println(e);
}
Here, first the program slurps the file into a List<String>, fixing the lines as it goes. Then it writes all the lines back out to the file.
There are circumstances in which this model is appropriate. For example, you might be building a non-linear data structure from the file content. Or you might need to see the last line before you can modify earlier lines (and be unable to re-open the data source from the start).
However I'd suggest a method that's more thrifty with memory. You don't need to keep all those lines in memory. You can read one line, fix it up, then forget about it. But to do this, you'll need to write to a second file.
String filein = "inputfile";
String fileout = filein + ".tmp";
try(
BufferedReader reader = new BufferedReader(new FileReader(filein));
Writer writer = new BufferedWriter(FileWriter(fileout))
) {
while ((String line = bufferedReader.readLine()) != null) {
writer.write(line.replace("þ", "t");
}
}
Files.move(Paths.get(fileout)),
Paths.get(filein),
CopyOption.REPLACE_EXISTING);
I have left out the necessary exception catching -- add back in as required.

jTextArea saves only first line of text in text file using BufferedReader?

I am trying to save the multiple line output in a text file from my jTextArea(named as "outputarea" in a code) to my desired path, Everything is OK but the file being saved do not contain the whole output, but only first line oof text. I am using "\n" to break the line in jtextarea while giving multiple line output, does that make any difference or any other problem in this code, This code is just the code on saveAs button, output is coming from another methods I've created. Thanks in Advance!
private void saveAs() {
FileDialog fd = new FileDialog(home.this, "Save", FileDialog.SAVE);
fd.show();
if(fd.getFile()!=null)
{
fn=fd.getFile();
dir=fd.getDirectory();
filename = dir + fn +".txt";
setTitle(filename);
try
{
DataOutputStream d=new DataOutputStream(new FileOutputStream(filename));
holdText = outputarea.getText();
BufferedReader br = new BufferedReader(new StringReader(holdText));
while((holdText = br.readLine())!=null)
{
d.writeBytes(holdText+"\r\n");
d.close();
}
}
catch (Exception e)
{
System.out.println("File not found");
}
outputarea.requestFocus();
save(filename);
}
}

You should put the d.close(); after the completion of while loop, because just after writing the first line in the file using DataOutputStream, you are closing it and you don't let it to fulfill the whole job.
You can see even an error is wrote in your console:
File not found
This is not because it doesn't find your file, it's because in the iterations after the first, it tries to write into a closed stream. So only the first line is wrote then. So change you code like this:
while ((holdText = br.readLine()) != null) {
d.writeBytes(holdText + "\r\n");
}
d.close();
Also I can advise to use a PrintWriter instead of DataOutputStream. Then you can easily change the writeBytes into println method. In this way you don't need to append \r\n manually to each line you write.
Another good hint is to use a try-with-resource (in case you use java 7 or later) or at least a finally block to close your streams either way:
String holdText = outputarea.getText();
try (PrintWriter w = new PrintWriter(new File(filename));
BufferedReader br = new BufferedReader(new StringReader(holdText))) {
while ((holdText = br.readLine()) != null) {
w.println(holdText);
}
} catch (Exception e) {
System.out.println("File not found");
}
Good Luck.

Buffered Reader/Writer flushes files

I'm trying to create a method that replaces every line in my file with a given. Instead it just makes the file empty. Care to take a look and see what is up? Thanks.
try {
FileReader fr = new FileReader(chooser.getSelectedFile());
BufferedReader reader = new BufferedReader(fr);
FileWriter fw = new FileWriter(chooser.getSelectedFile());
BufferedWriter bw = new BufferedWriter(fw);
String line = reader.readLine();
Scanner scan = null;
int i=0;
while (line != null) {
scan = new Scanner(line);
ln = scan.toString() + add;
bw.write(ln);
bw.newLine();
i++;
System.out.println(i + " pass");
line = reader.readLine();
}
reader.close();
bw.close();
} catch (FileNotFoundException e) {
System.out.println("Can't find the file");
} catch (IOException e) {
System.out.println("Dude, it's impossibru to read.");
}
The i in this method is too see how many passes the programme goes through a while loop, in this case 0, it doesn't initiate a while loop at all.

If you want to overwrite the same file with your new lines you should do first all the reading, and then all the writing.
ArrayList<String> lines = new ArrayList<String>();
//start reader, go over each line
while (line != null) {
String newLine = //make changes to line
lines.add(newLine);
}
//close reader
//start writer
//write each line to file

You opened file in replace mode, your FileWriter will empty file before first line will be written. Use FileWriter(file,true) if you want to append.
Second problem is you are reading and writing at the same time. Try next sequence:
read whole file
replace all lines
write (replace old file)
Thus you will minimize problems count

I want to open a text file and edit a specific line in java

This is code i Have written instead of editing a particular line new name gets appened at the last...
please help me out....
PrintWriter writer = new PrintWriter(new BufferedWriter(
new FileWriter("d:\\book.txt", true)));
BufferedReader br = null;
FileReader reader = null;
try {
reader = new FileReader("d:\\book.txt");
br = new BufferedReader(reader);
String line;
System.out.println((";;;;;;;;;;;;;;;;" + request
.getParameter("hname")));
System.out.println(request.getParameter("book"));
while ((line = br.readLine()) != null) {
if (request.getParameter("hname").equals(line)) {
line = line.replace(request.getParameter("hname"),
request.getParameter("book"));
writer.println(line);
writer.close();
}
}
} catch (FileNotFoundException e) {
e.printStackTrace();
}finally{
reader.close();
}

Unless you aren't changing the (byte) length of the line, you need to rewrite the whole file, adding the changed line where appropriate. This is actually just a simple change from your current code. First, initialize your FileWriter without the append (since you don't want to just append to the end of the file, which is what you're doing now).
PrintWriter writer = new PrintWriter(new BufferedWriter(new FileWriter("d:\\book.txt")));
Then, either read the whole file into memory (if the file is small enough) or else write a temp file as you go and then copy it over when you're done. The second way is more robust, and requires less code changing; just modify your while loop to write every line, modified or not.
// Open a temporary file to write to.
PrintWriter writer = new PrintWriter(new BufferedWriter(new FileWriter("d:\\book.temp")));
// ... then inside your loop ...
while ((line = br.readLine()) != null) {
if (request.getParameter("hname").equals(line)) {
line = line.replace(request.getParameter("hname"),
request.getParameter("book"));
}
// Always write the line, whether you changed it or not.
writer.println(line);
}
// ... and finally ...
File realName = new File("d:\\book.txt");
realName.delete(); // remove the old file
new File("d:\\book.temp").renameTo(realName); // Rename temp file
Don't forget to close all your file handles when you're done!

How to read a text file into jtextarea in Java Swing

Here is my code:
try {
String textLine;
FileReader fr = new FileReader("ad.txt");
BufferedReader reader = new BufferedReader(fr);
while((textLine=reader.readLine()) != null) {
textLine = reader.readLine();
jTextArea1.read(reader, "jTextArea1");
}
}
catch (IOException ioe) {
System.err.println(ioe);
System.exit(1);
}
And my .txt file contains the following:
contig00001 length=586 numreads=4
CGGGAAATTATCcGCGCCTTCACCGCCGCCGGTTCCACCGACGAACGGATACTGCGtGaa
ggCCGCGATCCCGTCggaCGGAAAaCGCCcTGGCCCGGGAaCATACCGTTCGGGCCGCCA
AGTGTTATAGCCGGACCACTTGTCAGAACATTTCCaaTCCGAAGATGTGAGTtCGGAAGg
TAAAAGCCCGACAAGTTGCGCGgTGAATTTACCTTtACcGCACGATATGCGTCCGTATTA
AaGAAAaGTTCGAAATTATCAGTAAGGCCGACCTGAAaGCTGACCGGGAGTTCAACAAAA
TCTGCATCACCcGGgTCACGGTCGAAATTGCTGTACGCGGCGCTGAACGTAAATTCACCC
TTTcTAAGGGTGTCGCcGTCGTAAACCGTAAaCAaGCCGGTAGCGCCGCCCATCGGGCCG
CCGGTACCAACCGTCGGTGCCGTGTTTCTtGCATCATTGTCCGATCGAGCGTTCTCGTCC
GCTTGTGCAAaTCCTGCAaTAGCTAACGTGAAAACGATCAGAGCTGTTGTAAATACTCTA
TAAGCGAGATTCATCACATTCCTCcGCCGAAATAAAAAGTTAATTt
contig00002 length=554 numreads=4
TGCGCCAaCCGCGCTCTtCATAAaTGGGCACTGCTCCCGATGGCCgACTCGGGCGGTTCG
CCATGAGATCTTTGCCtACCcAGgAaCtCACcACCAAGTCTGATTGCTGTGTGTTTtCTT
CAAGTCCCTATTTCTATTCtCTTtAATGGAACCCGTAGGAAACCCGTGTAGGACGCGGGA
aCCGCACTTgAAGGGGGAGGCGCGGGGTACCGGtCCGGGAACGTACGGGTACCGGCGGGG
gAGGGGAGGGGGACCgCTCCGGGAAGGCCAGGGGACGGATTGGGGAAGGgCGGGTACCGA
AGCGGGgAAaTGGGggAaCcGGCGAGAGGGTTCCTCGCTAAGTGGGGGAAATaGGGGAAA
GGTTGACCAGTGGTtCCCcGCTCTCGTAACATGCCTCAGATAGCGCCATCCGCTGTACCT
GGtcaggtcGctggcaacttcggccgagcaggtgaacccgaaaggtgagggtcagtgtga
cacaccaaccgaacaccgacgaggcaagcgtaggagccggcgtggccgcgcccggcggcg
ctgaggactcctcg
But shows the output by skipping the first two lines.
What is the reason for this?

You don't need the while loop, or the readLine method. Just call jtextArea1.read(reader, "jTextArea1")
Edit: update following your comment. If you want to skip all lines starting with >, you will need to read the file manually and then append each line to your textArea.
So something like:
String line;
while ((line = reader.readLine()) != null)
{
if (!line.startsWith(">"))
{
jTextArea.append(line + "\n");
}
}

Use:
FileReader reader = new FileReader("filename.txt");
txtarea.read(reader, "filename.txt"); //Object of JTextArea
You need only the above two lines to read from a file and put it into JTextArea...

The problem must have been solved by the time, yet there's still no answer to the question why the first two lines are skipped.
You create reader and then read the first two lines from the file, remaining lines are loaded into jTextArea1.
Your code:
/* 1 */ while((textLine=reader.readLine())!=null){
/* 2 */ textLine = reader.readLine();
/* 3 */ jTextArea1.read(reader,"jTextArea1");
}
Line 1 reads the first line from the file. Then in the body of while you read the second line from the file at line 2. Line 3 reads the rest of the file into jTextArea1.
On the next iteration of the while loop, reader.readLine() returns null since the file is completely read.
To load text in a JTextComponent use its read method as suggested by Phill and Bhushankumar.
The second parameter to read is not used by JTextArea, so it's safe to pass null. This second parameter is usually used to store to URL of the loaded file to resolve relative references, for example links in an HTMLDocument.

textLine = reader.readLine(); is called twice...
Fixed:
try {
String textLine;
FileReader fr = new FileReader("ad.txt");
BufferedReader reader = new BufferedReader(fr);
while((textLine=reader.readLine()) != null){
// textLine = reader.readLine(); // Remove this line
jTextArea1.read(reader, "jTextArea1");
}
}
catch (IOException ioe) {
System.err.println(ioe);
System.exit(1);
}

Correctly is:
try {
FileReader fr = new FileReader("tablica.txt");
BufferedReader reader = new BufferedReader(fr);
do {
l.read(reader, null);
}
while ((textLine=reader.readLine()) != null)
;
}
catch (IOException ioe) {
System.err.println(ioe);
System.exit(1);
}