I would like to create a JTable whose global layout would look somewhat like excel's.
To get this result I used the Groupable Header's code from crionics.com, but as you can see components of the header are not aligned vertically.
Moreover, I would like to be able to write multi line text in the rows of the documents where it's needed, but I am not able to get both multi line cells, multi line header cells, and groupable columns to work at the same time.
Look into the JIDE Grids. If you are working for commercial project, it's cheaper to buy these kind of things than write them yourself.
Related
How can I create a drop list in excel like drop list in html with the inbuilt "value" like attribute?
My Requirement is: I want to show the description which is not stored in database, but the code for description.
Ex: I have a subject list in an excel cell, for Science the description is "Science", but I want to store the code "SCI" in the Database.
You could use an ActiveX ComboBox in a worksheet, available from the Developers tab.
Enter both columns of data into the worksheet - you can hide the columns. Then set properties of the combobox:
ColumnCount 2
BoundColumn 1
ColumnWidths 0 pt; 20 pt
Set the ListFillRange and LinkedCell.
I understand there used to be issues with distributing workbooks containing ActiveX controls. I am not sure if this is still an issue, particularly when used a common (standard) control.
Of course, Excel is not designed to be a front-end to a database, so you'll need to write all the code to keep everything in-sync.
You could use the simpler Form Control/ComboBox. This will only store the index number in a cell - it does not have any events that you can use. You could use a formula based on the linked cell, that stores the description in another cell. When the user (presumably) clicks a button to submit the data, you would retrieve and store the description from this cell.
Hmm I can see many placeholder occurs all around the web related to java poi... but it seems there is no solution for your question. The only way I found to manage this is to set the cell value with my default text - the first value!
My target is to display an abbreviation list with two entries per line: the abbreviation and the corresponding long version. For a nice layout I used a GridPane because of the vertical alignment over all entries - it's nice to read.
But I also want to scroll to the clicked abbreviation and set the focus on it like in a ListView version of it.
For example the # on page links in good old HTML. Is there another javafx layout element I miss to achieve this?
I don't believe there is a provided control that will work for the specific scenario you are describing. However, I think one of these options might work for you...
Use the TableView control and add two columns for the information you want to show (one for the abbreviation and another for the long version). TableViews also have the scrollTo and setFocus functionality you're looking for. Here is a good resource to get you started with the Tableview control. You can also style the Tableview with CSS to look less like a table and more like a list if thats what your intention is.
The second option is to set a custom cell factory on your ListView that builds custom cells using HBoxes, VBoxes, Labels, etc. to achieve your desired look. You would also want to use the cell factory to populate each ListView cell with an object that contains both the abbreviated text and long version text. A couple good resources, 1, 2
Although I think both option will work fine, I would suggest option 1 since in option 2 you are sort of building a table type structure anyway. I hope this is helpful!
I am trying to make a properties frame just like the one in netBeans (or Visual Studio). My problem is that I don't know exactly how to design it. First I thought I'll make it with JTable (2 columns, multiple rows) but then I realised that on the second column I will have different types of values (booleans, String, color choosers, etc.), but I think that JTable allows only 1 type of data to be placed in a column.
I would like someone to tell me "JTable allows multiple data types on the same column" and show me how to do it, or tell me a different approach to the problem.
You can perfectly tell a JTable to have a column that contains Object, this way you will be able to put whatever ou want in.
BUT.
You'll then have to implement a very good TableCellRenderer/TableCellEditor pair in order to display whatever the cell contains.
Another option would be to use a Grid or GridBag layout inside of a JScrollPane, then dynamically populate the cells of the grid with different editors depending on the data type of the property.
If you can use external libraries, the JGoodies FormLayout is really suited to create such dialogs. Just take a look at the screenshots in their demo.
There is also a rather good PDF available containing with some examples and explanations.
I've got a blocking problem with the sorting functionality of a JTable; this made stall the development of the spare time open source project for 4 months now. Hope to be pointed into the right direction here.
Context: I'm working on extending the functionality of the ps3mediaserver to add a media library with pms-mlx. The UI of the media server has been done using swing.
Problem: When clicking on a column header in the JTable, a seemingly random column gets sorted instead of the one having been clicked.
Current implementation: Here's the description of the different components and classes being used for the implementation:
ETable: As alternate row colours aren't supported by default in the JTable, I've switched to the ETable extending the JTable. Source comes from here
FileDisplayTable: This is the class creating the table. In the init() method, the sorting is being enabled with 'table.setAutoCreateRowSorter(true);'
FileDisplayTableCellRenderer: Exists to always align cell content on the left
FileDisplayTableColumnModel: Does some mapping between internal types and column names
FileDisplayTableAdapter: This class implements com.jgoodies.binding.adapter.AbstractTableAdapter to map the objects with the table columns.
Possible solutions:
Preferably, I'd like to keep the current implementation and figure out how to correct the sorting, but I doubt someone can help me out with that!? Additionally their are some bits of code I had to add because of strange behaviours; they're commented in the code
The alternate option would be to change the JTable for another control altogether. I've made some research but didn't find the solution I was hoping for. The constraints are that
it must be embeddable in a swing UI
preferably it should support data bindings
support alternate row colours
row sorting
At some point it will be possible to open an editing dialogue, where the content of the row has to be retrieved, can be edited and when saved the row has to be updated.
Before reworking the entire thing I'd like to be sure the component will be able to handle all I want to do with it.
I'm more used to create GUIs using .NET in Visual Studio. It's quite different and a lot more difficult to do the same with swing. Please show me I'm wrong :)
[edit] If someone is willing to reproduce the problem, either get the source or the binaries, launch the application, navigate to the media library tab. In the Genral section import some videos by adding some video files. Go to the library section, click on apply to refresh the list and try to sort the table.
It may be useful to know that JTable columns can be dragged by the user. As a result, the view (JTable or a subclass) and model (an implementation of TableModel) may have different column numbers. Similarly, a RowSorter may affect the order or number of rows in the view as compared to the model. The related conversion methods are mentioned in How to Use Tables: Sorting and Filtering. In particular: "When using a sorter, always remember to translate cell coordinates."
Addendum: As an alternative, consider org.netbeans.swing.etable.ETable or it's subclass org.netbeans.swing.outline.Outline, depicted here.
Here is a typical input .txt file (also called as fasta file):
>contig00001 length=586 numreads=4
CGGGAAATTATCcGCGCCTTCACCGCCGCCGGTTCCACCGACGAACGGATACTGCGtGaa
ggCCGCGATCCCGTCggaCGGAAAaCGCCcTGGCCCGGGAaCATACCGTTCGGGCCGCCA
AGTGTTATAGCCGGACCACTTGTCAGAACATTTCCaaTCCGAAGATGTGAGTtCGGAAGg
TAAAAGCCCGACAAGTTGCGCGgTGAATTTACCTTtACcGCACGATATGCGTCCGTATTA
AaGAAAaGTTCGAAATTATCAGTAAGGCCGACCTGAAaGCTGACCGGGAGTTCAACAAAA
TCTGCATCACCcGGgTCACGGTCGAAATTGCTGTACGCGGCGCTGAACGTAAATTCACCC
TTTcTAAGGGTGTCGCcGTCGTAAACCGTAAaCAaGCCGGTAGCGCCGCCCATCGGGCCG
CCGGTACCAACCGTCGGTGCCGTGTTTCTtGCATCATTGTCCGATCGAGCGTTCTCGTCC
GCTTGTGCAAaTCCTGCAaTAGCTAACGTGAAAACGATCAGAGCTGTTGTAAATACTCTA
TAAGCGAGATTCATCACATTCCTCcGCCGAAATAAAAAGTTAATTt
>contig00002 length=554 numreads=4
TGCGCCAaCCGCGCTCTtCATAAaTGGGCACTGCTCCCGATGGCCgACTCGGGCGGTTCG
CCATGAGATCTTTGCCtACCcAGgAaCtCACcACCAAGTCTGATTGCTGTGTGTTTtCTT
CAAGTCCCTATTTCTATTCtCTTtAATGGAACCCGTAGGAAACCCGTGTAGGACGCGGGA
aCCGCACTTgAAGGGGGAGGCGCGGGGTACCGGtCCGGGAACGTACGGGTACCGGCGGGG
gAGGGGAGGGGGACCgCTCCGGGAAGGCCAGGGGACGGATTGGGGAAGGgCGGGTACCGA
AGCGGGgAAaTGGGggAaCcGGCGAGAGGGTTCCTCGCTAAGTGGGGGAAATaGGGGAAA
GGTTGACCAGTGGTtCCCcGCTCTCGTAACATGCCTCAGATAGCGCCATCCGCTGTACCT
GGtcaggtcGctggcaacttcggccgagcaggtgaacccgaaaggtgagggtcagtgtga
cacaccaaccgaacaccgacgaggcaagcgtaggagccggcgtggccgcgcccggcggcg
ctgaggactcctcg
Code to read the sequence may be found here.
It gives the proper output, as shown below with tab seperation:
contig00001 586 52.38
contig00002 554 62.45
The problem is that I developed a form in NetBeans that consists of a JTable having 5 columns i.e:
"contigID","Description","Organism","Sequence_length","Gc_percentage"
and a JTextArea. I want to display the above output in the JTable columns, while the other columns remain empty; and when I click 'contig00001' in JTable, then respective sequence like "CGGGAAAT...." should be displayed in the JTextArea.
How can I do that? Any suggestion would be appreciated.
I'm not exactly sure what you're stuck on. If it's adding data to the JTable, I'd consider creating a DefaultTableModel object, constructing it with the correct column header Strings in an array, with 0 rows of data, and then adding rows of data as you read through your files. The JTable tutorial should help you do all of this. Once you have your table model created, you can add it to your JTable easily via its setModel method.
One approach is to extend AbstractTableModel, as discussed in Creating a Table Model.
Addendum: By listening for a user selection, you can determine which row was selected and update your JTextArea accordingly.
Addendum: Because data retrieval may be prtotracted, SwingWorker offers a safe way to mutate the TableModel. Here's a simple example.