We Keep Coding

Invert functionality of row and column in JTable

I want to display data about a Java Object in a JTable in my GUI. In a traditional JTable the rows are Objects (or whatever data representation) and the columns describe the data of the objects. I want to do the opposite. I want the rows to list the name of the data of the object and the column to show the value of the data. I will only have 1 object in the table so I want the table to display data vertically instead of horizontally if that makes sense.
It appears that JTable is not designed to flip the functionality of rows and columns so my question is what is the best way to implement this? I know all of the names of the data I want to include as rows so I think I could just hardcode everything, but that doesn't seem very elegant.

How to put certain Data on Column in JTable?

Im Very New in java and im still learning how to put data on notepad. but i want to put one text to the JTable. I Dont know how to put those arrowed text into JTable

You should make a TableModel then add rows of data to your table model. There is plenty of information here https://docs.oracle.com/javase/tutorial/uiswing/components/table.html

How to add checkboxes to a JTable which uses a model with values from a database?

I have a model(AbstracTableModel) which I use to build a JTable.
The thing is that the table cell values seen in the GUI are displayed from a database.
How can I add a new column with checboxes for each row of the table?
Is there a concrete answer to this?

The thing is that the table cell values seen in the GUI are displayed from a database.
Use a DefaultTableModel to store the data from the database.
See the TableFromDatabaseExample.java code found in Table From Database for simple code to load the DefaultTableModel.
How can I add a new column with checboxes for each row of the table?
You can modify the above code to add an extra column to the "columnNames" Vector. Then in the looping code you add a Boolean.FALSE object to the "row" Vector.
Or, after creating the DefaultTableModel with the data from the database you can use the addColumn(...) method of the DefualtTableModel to create your column of check boxes.

How can delete/hide the mid row(5)th row before it listed in jtable

Here i have an 1-10 row is listed in jtable i want to delete/hide the 5th row before it listed in jtable.
i set the rowheight but it affected the cellselection.Is there any way to hide/delete the row without affected the normal flow code?
If i remove the row it will throws ArrayIndexoutofBoundException.
in my project executed means one gui open in that gui listed the some string. In here we can add the more string via Add Button on popup Button
Here what i need is i have to hide the particular string. That string is placed on 1st row.
i need to hide the string from end user.
now u hope understand.

You can use the JTable row filtering support in order to hide certain rows without deleting them from the model. Also see this: How can I filter rows in a JTable?

You can eliminate rows in the table by calling the removeRow() method. If you want to just hide it instead of elimintaing it you need to customize the JTable's model to meet your specs on what to display.
http://docs.oracle.com/javase/tutorial/uiswing/components/table.html

using DefaultTableModel with JTable you should be able to use model.removeRow(int row) function to remove A row from JTable. There is no way to hide a row based on index as much as i know. However, If you need to hide and re-show mechanism you need to save the row prior to delete it and Save the removedRow in a ArrayList to re-use them.. Something as follows:
List<Vector>deletedRows = new ArrayList<>();
Vector removingRow = (Vector) model.getDataVector().get(5);
deletedRows.add(removingRow);
model.removeRow(5);

Steps to read the text file into specific columns of JTable using biojava

Here is a typical input .txt file (also called as fasta file):
>contig00001 length=586 numreads=4
CGGGAAATTATCcGCGCCTTCACCGCCGCCGGTTCCACCGACGAACGGATACTGCGtGaa
ggCCGCGATCCCGTCggaCGGAAAaCGCCcTGGCCCGGGAaCATACCGTTCGGGCCGCCA
AGTGTTATAGCCGGACCACTTGTCAGAACATTTCCaaTCCGAAGATGTGAGTtCGGAAGg
TAAAAGCCCGACAAGTTGCGCGgTGAATTTACCTTtACcGCACGATATGCGTCCGTATTA
AaGAAAaGTTCGAAATTATCAGTAAGGCCGACCTGAAaGCTGACCGGGAGTTCAACAAAA
TCTGCATCACCcGGgTCACGGTCGAAATTGCTGTACGCGGCGCTGAACGTAAATTCACCC
TTTcTAAGGGTGTCGCcGTCGTAAACCGTAAaCAaGCCGGTAGCGCCGCCCATCGGGCCG
CCGGTACCAACCGTCGGTGCCGTGTTTCTtGCATCATTGTCCGATCGAGCGTTCTCGTCC
GCTTGTGCAAaTCCTGCAaTAGCTAACGTGAAAACGATCAGAGCTGTTGTAAATACTCTA
TAAGCGAGATTCATCACATTCCTCcGCCGAAATAAAAAGTTAATTt
>contig00002 length=554 numreads=4
TGCGCCAaCCGCGCTCTtCATAAaTGGGCACTGCTCCCGATGGCCgACTCGGGCGGTTCG
CCATGAGATCTTTGCCtACCcAGgAaCtCACcACCAAGTCTGATTGCTGTGTGTTTtCTT
CAAGTCCCTATTTCTATTCtCTTtAATGGAACCCGTAGGAAACCCGTGTAGGACGCGGGA
aCCGCACTTgAAGGGGGAGGCGCGGGGTACCGGtCCGGGAACGTACGGGTACCGGCGGGG
gAGGGGAGGGGGACCgCTCCGGGAAGGCCAGGGGACGGATTGGGGAAGGgCGGGTACCGA
AGCGGGgAAaTGGGggAaCcGGCGAGAGGGTTCCTCGCTAAGTGGGGGAAATaGGGGAAA
GGTTGACCAGTGGTtCCCcGCTCTCGTAACATGCCTCAGATAGCGCCATCCGCTGTACCT
GGtcaggtcGctggcaacttcggccgagcaggtgaacccgaaaggtgagggtcagtgtga
cacaccaaccgaacaccgacgaggcaagcgtaggagccggcgtggccgcgcccggcggcg
ctgaggactcctcg
Code to read the sequence may be found here.
It gives the proper output, as shown below with tab seperation:
contig00001 586 52.38
contig00002 554 62.45
The problem is that I developed a form in NetBeans that consists of a JTable having 5 columns i.e:
"contigID","Description","Organism","Sequence_length","Gc_percentage"
and a JTextArea. I want to display the above output in the JTable columns, while the other columns remain empty; and when I click 'contig00001' in JTable, then respective sequence like "CGGGAAAT...." should be displayed in the JTextArea.
How can I do that? Any suggestion would be appreciated.

I'm not exactly sure what you're stuck on. If it's adding data to the JTable, I'd consider creating a DefaultTableModel object, constructing it with the correct column header Strings in an array, with 0 rows of data, and then adding rows of data as you read through your files. The JTable tutorial should help you do all of this. Once you have your table model created, you can add it to your JTable easily via its setModel method.

One approach is to extend AbstractTableModel, as discussed in Creating a Table Model.
Addendum: By listening for a user selection, you can determine which row was selected and update your JTextArea accordingly.
Addendum: Because data retrieval may be prtotracted, SwingWorker offers a safe way to mutate the TableModel. Here's a simple example.