We Keep Coding

Why Scala on Mac fails when run in unicode directory

I am attempting to simply compile a helloworld scala file from within a directory named using unicode characters but the scala compiler fails to run. It succeeds when I change directory's out the unicode named folder.
Detail
Given a classic Helloworld.scala class such as the one below
that is located in the directory:
/Users/me/Dev/Company/𝔘𝔫𝔦𝔠𝔬𝔡𝔢/code_folder
I am unable to run scalac on the code if my current directory is in code_folder which is the root directory for the Helloworld.scala. When I change directories out of the folder with the unicode name /𝔘𝔫𝔦𝔠𝔬𝔡𝔢, the compiler works just fine on the same code. So it would seem that scalac doesnt work when attempting to compile code while in a folder with unicode characters.
Why is that? Is this a system error? An unparsed unicode error between the OS starting the scalac process?
object Main{
def main(args: Array[String]): Unit = {
println("Hello world")
}
}
I expected a compiled file. The error I get is this
Exception in thread "main" java.lang.ExceptionInInitializerError
at scala.tools.util.PathResolver$Environment$.scalaExtDirs(PathResolver.scala:77)
at scala.tools.util.PathResolver$Defaults$.scalaExtDirs(PathResolver.scala:127)
at scala.tools.nsc.settings.StandardScalaSettings.$init$(StandardScalaSettings.scala:31)
at scala.tools.nsc.settings.MutableSettings.<init>(MutableSettings.scala:28)
at scala.tools.nsc.Settings.<init>(Settings.scala:19)
at scala.tools.nsc.Driver.process(Driver.scala:53)
at scala.tools.nsc.Driver.main(Driver.scala:80)
at scala.tools.nsc.Main.main(Main.scala)
Caused by: java.lang.IllegalArgumentException: Error decoding percent encoded characters
at java.base/sun.net.www.ParseUtil.decode(ParseUtil.java:209)
at java.base/jdk.internal.loader.FileURLMapper.getPath(FileURLMapper.java:64)
at java.base/jdk.internal.loader.FileURLMapper.exists(FileURLMapper.java:73)
at java.base/jdk.internal.loader.URLClassPath$JarLoader.getJarFile(URLClassPath.java:802)
at java.base/jdk.internal.loader.URLClassPath$JarLoader.access$900(URLClassPath.java:692)
at java.base/jdk.internal.loader.URLClassPath$JarLoader$1.run(URLClassPath.java:751)
at java.base/jdk.internal.loader.URLClassPath$JarLoader$1.run(URLClassPath.java:744)
at java.base/java.security.AccessController.doPrivileged(Native Method)
at java.base/jdk.internal.loader.URLClassPath$JarLoader.ensureOpen(URLClassPath.java:743)
at java.base/jdk.internal.loader.URLClassPath$JarLoader.<init>(URLClassPath.java:718)
at java.base/jdk.internal.loader.URLClassPath$3.run(URLClassPath.java:486)
at java.base/jdk.internal.loader.URLClassPath$3.run(URLClassPath.java:469)
at java.base/java.security.AccessController.doPrivileged(Native Method)
at java.base/jdk.internal.loader.URLClassPath.getLoader(URLClassPath.java:468)
at java.base/jdk.internal.loader.URLClassPath.getLoader(URLClassPath.java:437)
at java.base/jdk.internal.loader.URLClassPath.findResource(URLClassPath.java:280)
at java.base/jdk.internal.loader.BuiltinClassLoader.findResourceOnClassPath(BuiltinClassLoader.java:479)
at java.base/jdk.internal.loader.BuiltinClassLoader.findResource(BuiltinClassLoader.java:303)
at java.base/java.lang.ClassLoader.getResource(ClassLoader.java:1393)
at java.base/java.lang.ClassLoader.getSystemResource(ClassLoader.java:1658)
at java.base/java.lang.ClassLoader.getSystemResourceAsStream(ClassLoader.java:1762)
at java.base/java.lang.Class.getResourceAsStream(Class.java:2607)
at scala.util.PropertiesTrait.scalaProps(Properties.scala:39)
at scala.util.PropertiesTrait.scalaProps$(Properties.scala:37)
at scala.tools.reflect.WrappedProperties$AccessControl$.scalaProps$lzycompute(WrappedProperties.scala:49)
at scala.tools.reflect.WrappedProperties$AccessControl$.scalaProps(WrappedProperties.scala:49)
at scala.util.PropertiesTrait.scalaPropOrNone(Properties.scala:71)
at scala.util.PropertiesTrait.scalaPropOrNone$(Properties.scala:71)
at scala.tools.reflect.WrappedProperties$AccessControl$.scalaPropOrNone(WrappedProperties.scala:49)
at scala.util.PropertiesTrait.$init$(Properties.scala:83)
at scala.tools.reflect.WrappedProperties$AccessControl$.<init>(WrappedProperties.scala:49)
at scala.tools.reflect.WrappedProperties$AccessControl$.<clinit>(WrappedProperties.scala)
... 8 more
Version:
scalac -version
Scala compiler version 2.12.8 -- Copyright 2002-2018, LAMP/EPFL and Lightbend, Inc.
MacOS version 10.13.6

Not really a solution, but some piece of information:
I set up my folder this way:
/home/nicolas/Private/𝔘𝔫𝔦𝔠𝔬𝔡𝔢/
When the ClassLoader tries to load the classes of your project it makes a list of paths where to lookup classes as a list of URLClassPath
Now when the code goes on and it tries to parse these paths, it calls sun.net.www.ParseUtil.decode()
When I put a breakpoint in here, I can see that the path for our class is:
/home/nicolas/Private/%ed%a0%b5%ed%b4%98%ed%a0%b5%ed%b4%ab%ed%a0%b5%ed%b4%a6%ed%a0%b5%ed%b4%a0%ed%a0%b5%ed%b4%ac%ed%a0%b5%ed%b4%a1%ed%a0%b5%ed%b4%a2/target/scala-2.12/classes/
so it somehow translated 𝔘𝔫𝔦𝔠𝔬𝔡𝔢 into a percent encoded string : %ed%a0%b5%ed%b4%98%ed%a0%b5%ed%b4%ab%ed%a0%b5%ed%b4%a6%ed%a0%b5%ed%b4%a0%ed%a0%b5%ed%b4%ac%ed%a0%b5%ed%b4%a1%ed%a0%b5%ed%b4%a2
This in turn creates a CharsetDecoder for UTF-8:
CharsetDecoder dec = ThreadLocalCoders.decoderFor("UTF-8")
.onMalformedInput(CodingErrorAction.REPORT)
.onUnmappableCharacter(CodingErrorAction.REPORT);
and tries to decode the above url but it fails and that is why the classes can't be loaded.
Now if I go here https://www.branah.com/unicode-converter and tries to convert 𝔘𝔫𝔦𝔠𝔬𝔡𝔢 to a % encoded string, it gives me
%f0%9d%94%98%f0%9d%94%ab%f0%9d%94%a6%f0%9d%94%a0%f0%9d%94%ac%f0%9d%94%a1%f0%9d%94%a2
And if when I debug, I change the url using this encoded string value, ie
/home/nicolas/Private/%f0%9d%94%98%f0%9d%94%ab%f0%9d%94%a6%f0%9d%94%a0%f0%9d%94%ac%f0%9d%94%a1%f0%9d%94%a2/target/scala-2.12/classes/
Then it parses it properly and keeps going.
So I don't know where it gets that %ed%a0%b5%ed%b4%98%ed%a0%b5%ed%b4%ab%ed%a0%b5%ed%b4%a6%ed%a0%b5%ed%b4%a0%ed%a0%b5%ed%b4%ac%ed%a0%b5%ed%b4%a1%ed%a0%b5%ed%b4%a2
The interesting thing is that if I use the same website and try to convert back %ed%a0%b5%ed%b4%98%ed%a0%b5%ed%b4%ab%ed%a0%b5%ed%b4%a6%ed%a0%b5%ed%b4%a0%ed%a0%b5%ed%b4%ac%ed%a0%b5%ed%b4%a1%ed%a0%b5%ed%b4%a2 then I also get 𝔘𝔫𝔦𝔠𝔬𝔡𝔢
So I am a bit confused

Trimmomatic not acknowleding commands over Linux cluster

I am trying to use the program Trimmomatic to removed adapter sequences from an Illumina paired-end read over a computer cluster. While I can get the program to open, it will either not acknowledge the commands I enter or will return an error message. I have tried all kinds of permutations of the input commands without success. Examples of input code and error messages are below
Code:
java -classpath /*filepath*/Trimmomatic-0.32/trimmomatic-0.32.jar org.usadellab.trimmomatic.TrimmomaticPE \
-phred33 -trimlog /Results/log.txt \
~/*filepath*/data_R1.fq ~/*filepath*/data_R2.fq \
ILLUMINACLIP:/*filepath*/Trimmomatic-0.32/adapters/TruSeq3-PE-2.fa:2:30:10:3:"true"
Results: (the o/s seems to find and execute the software, but is not feeding in the command; I get the same result if I use the java -jar option for executing Trimmomatic)
TrimmomaticPE [-threads <threads>] [-phred33|-phred64] [-trimlog <trimLogFile>] [-basein <inputBase> | <inputFile1> <inputFile2>] [-baseout <outputBase> | <outputFile1P> <outputFile1U> <outputFile2P> <outputFile2U>] <trimmer1>...
Code: (If I add in the command PE immediately before all other commands, the program executes and can find the fasta file containing the adapter sequences, but then searches for and cannot fund a file called 'PE')
java -classpath /*filepath*/trimmomatic-0.32.jar org.usadellab.trimmomatic.TrimmomaticPE \
PE -phred33 -trimlog /Results/log.txt \
~/*filepath*/data_R1.fq ~/*filepath*/data_R2.fq \
ILLUMINACLIP:/*filepath*/Trimmomatic-0.32/adapters/TruSeq3-PE-2.fa:2:30:10:3:"true"
Results: (Programs rus and finds the fasta file of adapter sequences, but then fails to execute. Why is it looking for a PE file?)
TrimmomaticPE: Started with arguments: PE -phred33 -trimlog /Results/log.txt /*filepath*/data_R1.fq /*filepath*/data_R2.fq ILLUMINACLIP:/*filepath*/Trimmomatic-0.32/adapters/TruSeq3-PE-2.fa:2:30:10:3:true
Multiple cores found: Using 12 threads
Using PrefixPair: 'TACACTCTTTCCCTACACGACGCTCTTCCGATCT' and 'GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT'
Using Long Clipping Sequence: 'AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC'
Using Long Clipping Sequence: 'TACACTCTTTCCCTACACGACGCTCTTCCGATCT'
Using Long Clipping Sequence: 'GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT'
Using Long Clipping Sequence: 'AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA'
ILLUMINACLIP: Using 1 prefix pairs, 4 forward/reverse sequences, 0 forward only sequences, 0 reverse only sequences
Exception in thread "main" java.io.FileNotFoundException: PE (No such file or directory)
at java.io.FileInputStream.open(Native Method)
at java.io.FileInputStream.<init>(FileInputStream.java:146)
at org.usadellab.trimmomatic.fastq.FastqParser.parse(FastqParser.java:127)
at org.usadellab.trimmomatic.TrimmomaticPE.process(TrimmomaticPE.java:251)
at org.usadellab.trimmomatic.TrimmomaticPE.run(TrimmomaticPE.java:498)
at org.usadellab.trimmomatic.TrimmomaticPE.main(TrimmomaticPE.java:506)

I've never used trimmomatic but it looks like you are passing in the incorrect parameters.
the trimmomatic webpage lists the usage from version 0.27+ as:
java -jar <path to trimmomatic.jar> PE [-threads <threads] [-phred33 | -phred64] [-trimlog <logFile>] <input 1> <input 2> <paired output 1> <unpaired output 1> <paired output 2> <unpaired output 2> <step 1> ...
or using the "old way"
java -classpath <path to trimmomatic jar> org.usadellab.trimmomatic.TrimmomaticPE [-threads <threads>] [-phred33 | -phred64] [-trimlog <logFile>] <input 1> <input 2> <paired output 1> <unpaired output 1> <paired output 2> <unpaired output 2> <step 1> ...
Where the only difference is the new way is specifying "PE" as the main class instead of a fully qualified path.
First, addressing your 2nd problem:
You look like you are doing both: specifying a fully qualified class name as well as the PE part. This makes trimmomatic think you have a fastq file named "PE" which doesn't exist.
If you get rid of the "PE" OR the qualfited class name; it will call the correct class. Which is what you do first in your first problem.
1st problem
I don't think you have the correct number of arguments listed in your first invocation so trimmomatic displays the usage to tell you what parameters are required. It would be nice if it told you what was wrong but it doesn't.
Solution
It looks like you are only providing 2 fastq files but trimmmoatic needs 6 file paths. You are missing the output paired and unpaired files paths for the read 1 and read 2 data which I assume get created by the program when it runs.
I guess your 2nd attempt got further along in the program since it saw enough parameters that you potentially had enough file paths specified (however, it turns out you had optional step parameters)

Following the advice of dkatzel below and user blakeoft on SeqAnswers (http://seqanswers.com/forums/showthread.php?t=45094), I dropped the PE flag and added individual file names for each output file and the program executed properly.
java -classpath /*filepath*/Trimmomatic-0.32/trimmomatic-0.32.jar org.usadellab.trimmomatic.TrimmomaticPE \
-phred33 \
~/refs/lec12/data_R1.fq ~/refs/lec12/data_R2.fq \
lane1_forward_paired.fq lane1_forward_unpaired.fq lane1_reverse_paired.fq lane1_reverse_unpaired.fq \
ILLUMINACLIP:/*filepath*/Trimmomatic-0.32/adapters/TruSeq3-PE-2.fa:2:30:10:3:true
NB: I also tried using the -baseout flag rather than a list of four files, and the program would open but not execute any commands
NB: The a log file could be generated using the flag -trimlog filename, but only if I first made a blank text file with the same name as the intended log file.

I want to find Word similarity Using WordNet

I am doing final year project on "web video categorization", in which one part is to find the similar (synonyms) words for a particular word and I want to remove similar terms from it.
I know Java language, so I chosen "Word Similarity For Java" ws4j
For that I have only used WS4J1.0.1 jar file , even I have not downloaded any extra files like WordNet lexical database or sqlite database to store it. Because in that website they have mentioned that all are contained as precompiled in this jar file.
When I executed Demo program SimilarityCalculationDemo.java, I got the following errors:
java.sql.BatchUpdateException: batch entry 0: [SQLITE_CORRUPT] The database disk image is malformed (database disk image is malformed)
at org.sqlite.Stmt.executeBatch(Stmt.java:226)
at org.sqlite.Stmt.executeBatch(Stmt.java:226)
at edu.cmu.lti.jawjaw.db.SQL.createIndexIfNotExists(SQL.java:118)
at edu.cmu.lti.jawjaw.db.SQL.createSQLConnection(SQL.java:98)
at edu.cmu.lti.jawjaw.db.SQL.<init>(SQL.java:55)
at edu.cmu.lti.jawjaw.db.SQL.<clinit>(SQL.java:45)
at edu.cmu.lti.jawjaw.db.WordDAO.findWordsByLemmaAndPos(WordDAO.java:124)
at edu.cmu.lti.jawjaw.util.WordNetUtil.wordToSynsets(WordNetUtil.java:38)
at edu.cmu.lti.lexical_db.NictWordNet.getAllConcepts(NictWordNet.java:38)
atedu.cmu.lti.ws4j.util.WordSimilarityCalculator.calcRelatednessOfWords(WordSimilarityCalculator.java:79)
at edu.cmu.lti.ws4j.RelatednessCalculator.calcRelatednessOfWords(RelatednessCalculator.java:61)
at web_cat.SimilarityCalculationDemo.run(SimilarityCalculationDemo.java:37)
at web_cat.SimilarityCalculationDemo.main(SimilarityCalculationDemo.java:43)
java.sql.SQLException: [SQLITE_CORRUPT] The database disk image is malformed (database disk image is malformed)
at org.sqlite.DB.newSQLException(DB.java:383)
at org.sqlite.DB.newSQLException(DB.java:387)
at org.sqlite.DB.throwex(DB.java:374)
at org.sqlite.NativeDB.prepare(Native Method)
at org.sqlite.DB.prepare(DB.java:123)
at org.sqlite.Stmt.execute(Stmt.java:113)
at edu.cmu.lti.jawjaw.db.SQL.setPragmaCacheSize(SQL.java:137)
at edu.cmu.lti.jawjaw.db.SQL.createSQLConnection(SQL.java:99)
at edu.cmu.lti.jawjaw.db.SQL.<init>(SQL.java:55)
at edu.cmu.lti.jawjaw.db.SQL.<clinit>(SQL.java:45)
at edu.cmu.lti.jawjaw.db.WordDAO.findWordsByLemmaAndPos(WordDAO.java:124)
at edu.cmu.lti.jawjaw.util.WordNetUtil.wordToSynsets(WordNetUtil.java:38)
at edu.cmu.lti.lexical_db.NictWordNet.getAllConcepts(NictWordNet.java:38)
at edu.cmu.lti.ws4j.util.WordSimilarityCalculator.calcRelatednessOfWords(WordSimilarityCalculator.java:79)
at edu.cmu.lti.ws4j.RelatednessCalculator.calcRelatednessOfWords(RelatednessCalculator.java:61)
at web_cat.SimilarityCalculationDemo.run(SimilarityCalculationDemo.java:37)
at web_cat.SimilarityCalculationDemo.main(SimilarityCalculationDemo.java:43)
java.sql.SQLException: [SQLITE_CORRUPT] The database disk image is malformed (database disk image is malformed)
at org.sqlite.DB.newSQLException(DB.java:383)
at org.sqlite.DB.newSQLException(DB.java:387)
at org.sqlite.DB.throwex(DB.java:374)
at org.sqlite.NativeDB.prepare(Native Method)
at org.sqlite.DB.prepare(DB.java:123)
at org.sqlite.PrepStmt.<init>(PrepStmt.java:42)
at org.sqlite.Conn.prepareStatement(Conn.java:404)
at org.sqlite.Conn.prepareStatement(Conn.java:399)
at org.sqlite.Conn.prepareStatement(Conn.java:383)
at edu.cmu.lti.jawjaw.db.SQL.prepareStatements(SQL.java:151)
at edu.cmu.lti.jawjaw.db.SQL.<init>(SQL.java:56)
at edu.cmu.lti.jawjaw.db.SQL.<clinit>(SQL.java:45)
at edu.cmu.lti.jawjaw.db.WordDAO.findWordsByLemmaAndPos(WordDAO.java:124)
at edu.cmu.lti.jawjaw.util.WordNetUtil.wordToSynsets(WordNetUtil.java:38)
at edu.cmu.lti.lexical_db.NictWordNet.getAllConcepts(NictWordNet.java:38)
at edu.cmu.lti.ws4j.util.WordSimilarityCalculator.calcRelatednessOfWords(WordSimilarityCalculator.java:79)
at edu.cmu.lti.ws4j.RelatednessCalculator.calcRelatednessOfWords(RelatednessCalculator.java:61)
at web_cat.SimilarityCalculationDemo.run(SimilarityCalculationDemo.java:37)
at web_cat.SimilarityCalculationDemo.main(SimilarityCalculationDemo.java:43)
Exception in thread "main" java.lang.NullPointerException
at edu.cmu.lti.jawjaw.db.WordDAO.findWordsByLemmaAndPos(WordDAO.java:125)
at edu.cmu.lti.jawjaw.util.WordNetUtil.wordToSynsets(WordNetUtil.java:38)
at edu.cmu.lti.lexical_db.NictWordNet.getAllConcepts(NictWordNet.java:38)
at edu.cmu.lti.ws4j.util.WordSimilarityCalculator.calcRelatednessOfWords(WordSimilarityCalculator.java:79)
at edu.cmu.lti.ws4j.RelatednessCalculator.calcRelatednessOfWords(RelatednessCalculator.java:61)
at web_cat.SimilarityCalculationDemo.run(SimilarityCalculationDemo.java:37)
at web_cat.SimilarityCalculationDemo.main(SimilarityCalculationDemo.java:43)
Java Result: 1
I am Using Netbeans IDE 7.4 with JDK 6.
Could any please assist me, how to overcome from this problem, because there is a less documentation available in the internet about ws4j.

Well, I could not reproduce your error. For me it just worked perfectly out of the box, using eclipse, so I'll try to help you reproducing exactly what I've did
download ws4j-1.0.1.jar from https://ws4j.googlecode.com/files/ws4j-1.0.1.jar and ensure it's size after the download is 41,362,723 bytes (at least, that's what eclipse told me in my linux box)
Use java 7
Create a simple eclipse project and drop the jar there. Then add the jar to the build path
(right click -> build path -> add)
Create an appropriate package and class to accommodate the demo class
Just run the demo and you'll get something like
edu.cmu.lti.ws4j.impl.HirstStOnge 0.0
edu.cmu.lti.ws4j.impl.LeacockChodorow 1.3862943611198906
edu.cmu.lti.ws4j.impl.Lesk 0.0
edu.cmu.lti.ws4j.impl.WuPalmer 0.4
edu.cmu.lti.ws4j.impl.Resnik 2.5031573470157453
edu.cmu.lti.ws4j.impl.JiangConrath 0.11150424023847051
edu.cmu.lti.ws4j.impl.Lin 0.3582442863008455
edu.cmu.lti.ws4j.impl.Path 0.14285714285714285
Done in 1951 msec.

what does the following statement mean?

In the http://ant.apache.org/manual/tutorial-HelloWorldWithAnt.html
echo Main-Class: oata.HelloWorld>myManifest
md build\jar
jar cfm build\jar\HelloWorld.jar myManifest -C build\classes .
java -jar build\jar\HelloWorld.jar
Note: Do not have blanks around the >-sign in the echo Main-Class instruction because it would falsify it!
Anyone know why there is such Note. I do not see any difference when we hae balnks around >-sign.

You are correct, it makes no difference. Not sure what the message on the tutorial means.

Just a guess.
It probably meant to stress the need for getting the line correctly copied. Main-Class attribute
Any value other than 'Main-Class:' will fail the jar creation.
With a white space after - Main - Class or
just before : 'Main-Class : gives the error invalid header field name: ..

Java command failed when running NLTK StanfordParser

EDITED
Thanks to Alvas' answer. I just learned that the following problem is caused by the 'not-so-up-to-date' NLTK since the latest 15-12-09 StanfordNLP requires more dependencies than previous versions. The exact solution to this problem is within this link https://github.com/nltk/nltk/issues/1239 as Alvas suggested.
StackOverflow identify my problem similar to this post Stanford Parser and NLTK. I still believe the two problems are different since the original one addresses more discussions on the overall proper setup of Standfordnlp while my question is focusing on the error itself. And after all, that doesn't solve my problem.
Follows is my post before I added these comments.
I've read almost all relative topics and possible solutions posted on Stackoverflow and tried them all on my computer. However, no positive result has been achieved. It is becoming frustrating everyday for an amature learning nlp and rookie in java because this problem prevents me from getting to know nltk at the very start. I would like to share the problem again and thanks again for all who tried to solve in advance.
Basically, I intend to parse Chinese characters but start from the English language. Here is the code I used (You probably have seen it because I copied it elsewhere to test):
import os
from nltk.parse import stanford
ini_path = 'C:/Users/qubo/jars/stanford-parser/'
os.environ['STANFORD_PARSER'] = ini_path + 'stanford-parser.jar'
os.environ['STANFORD_MODELS'] = ini_path + 'stanford-parser-3.6.0-models.jar'
os.environ['JAVAHOME'] = 'C:/Program Files/Java/jdk1.8.0_73/'
parser = stanford.StanfordParser(ini_path + 'stanford-parser.jar', ini_path + 'stanford-parser-3.6.0-models.jar')
sentences = parser.raw_parse_sents(("Python is fun. We should all date Python in this case."))
print (sentences)
for line in sentences:
for sentence in line:
sentence.draw()
And now I got this error msg when running parser.raw_parse_sents:
java.lang.NoClassDefFoundError: org/slf4j/LoggerFactory
at edu.stanford.nlp.parser.common.ParserGrammar.<clinit>(ParserGrammar.java:46)
Caused by: java.lang.ClassNotFoundException: org.slf4j.LoggerFactory
at java.net.URLClassLoader.findClass(URLClassLoader.java:381)
at java.lang.ClassLoader.loadClass(ClassLoader.java:424)
at sun.misc.Launcher$AppClassLoader.loadClass(Launcher.java:331)
at java.lang.ClassLoader.loadClass(ClassLoader.java:357)
... 1 more
Exception in thread "main"
Traceback (most recent call last):
File "C:\Users\qubo\Desktop\nltkexample.py", line 33, in <module>
sentences = parser.raw_parse_sents(("Python is fun. We should all date Python in this case."))
File "C:\Users\qubo\Miniconda2\lib\site-packages\nltk\parse\stanford.py", line 146, in raw_parse_sents
return self._parse_trees_output(self._execute(cmd, '\n'.join(sentences), verbose))
File "C:\Users\qubo\Miniconda2\lib\site-packages\nltk\parse\stanford.py", line 212, in _execute
stdout=PIPE, stderr=PIPE)
File "C:\Users\qubo\Miniconda2\lib\site-packages\nltk\internals.py", line 134, in java
raise OSError('Java command failed : ' + str(cmd))
OSError: Java command failed : ['C:/Program Files/Java/jdk1.8.0_73/bin\\java.exe', u'-mx1000m', '-cp', 'C:/Users/qubo/jars/stanford-parser/stanford-parser.jar;C:/Users/qubo/jars/stanford-parser/stanford-parser-3.6.0-models.jar', u'edu.stanford.nlp.parser.lexparser.LexicalizedParser', u'-model', u'edu/stanford/nlp/models/lexparser/englishPCFG.ser.gz', u'-sentences', u'newline', u'-outputFormat', u'penn', u'-encoding', u'utf8', 'c:\\users\\qubo\\appdata\\local\\temp\\tmppz8u6r']
[Finished in 0.7s]
I'm using windows 64, Python 2.7.11 and all modules supporting nltk and stanford parser are updated. I've installed the jdk and jre as well. In fact, I've tried different versions and jdk (old or latest, 86 or 64), none was working.
I've tried to set java path directly in internals.py or commenting raise error lines in standford.py, still not working.
I've tried to add JAVAHOME environment variable, no use. In fact, it serves the exact same purpose as this line (as some may claim to be slightly different):
os.environ['JAVAHOME'] = 'C:/Program Files/Java/jdk1.8.0_73/'
Any thoughts? Thanks again!!!

After spending too long on this problem, I finally found the answer buried in one of the comments of this question. I think it's worth posting as a proper answer since other people might look for it here and not find it (I know I missed it at first).
The answer is in this gist, which also contains instructions on how to solve this problem for all Stanford NLTK interfaces (i.e. NER tagger, POS tagger, and all Stanford parsers).
Basically, you need to change the Parser object's classpath property with this function:
from nltk.internals import find_jars_within_path
from nltk.parse.stanford import StanfordParser
parser = StanfordParser(model_path="path/to/englishPCFG.ser.gz")
parser._classpath = tuple(find_jars_within_path(stanford_dir))
All credit for the solution goes to alvas, I'm just reposting it here so it's easier to find.

You need to download slf4j jar from here and add that on the path as well.