SWT TableViewer summary row - java

How can I add summary row in TableViewer (or different Viewer from SWT), which (row) will be containing sum of all rows in proper column?
And by the way, the next question. Is it possible to set multiline header in TableViewer?
Thanks

There is no special way to do this.
Your table Content Provider will have to return an object containing the summary data.

Related

Droplist in Excel using Poi

How can I create a drop list in excel like drop list in html with the inbuilt "value" like attribute?
My Requirement is: I want to show the description which is not stored in database, but the code for description.
Ex: I have a subject list in an excel cell, for Science the description is "Science", but I want to store the code "SCI" in the Database.
You could use an ActiveX ComboBox in a worksheet, available from the Developers tab.
Enter both columns of data into the worksheet - you can hide the columns. Then set properties of the combobox:
ColumnCount 2
BoundColumn 1
ColumnWidths 0 pt; 20 pt
Set the ListFillRange and LinkedCell.
I understand there used to be issues with distributing workbooks containing ActiveX controls. I am not sure if this is still an issue, particularly when used a common (standard) control.
Of course, Excel is not designed to be a front-end to a database, so you'll need to write all the code to keep everything in-sync.
You could use the simpler Form Control/ComboBox. This will only store the index number in a cell - it does not have any events that you can use. You could use a formula based on the linked cell, that stores the description in another cell. When the user (presumably) clicks a button to submit the data, you would retrieve and store the description from this cell.
Hmm I can see many placeholder occurs all around the web related to java poi... but it seems there is no solution for your question. The only way I found to manage this is to set the cell value with my default text - the first value!

How to add row header to JFace TableViewer?

How can I add "row headers" to a Jface TableViewer?
Have a look at the Grid widget from the Nebula Project.
It does support "row headers".
A TableViewer does not by default provide this capability. But you can have a look at this snippet to achieve something similar to a row header. This example uses two tables to make the first column fixed and rest of the columns horizontally scrollable. If you do not want fixed columns than you can just use different colors for columns to achieve the look and feel of a row header.

Steps to read the text file into specific columns of JTable using biojava

Here is a typical input .txt file (also called as fasta file):
>contig00001 length=586 numreads=4
CGGGAAATTATCcGCGCCTTCACCGCCGCCGGTTCCACCGACGAACGGATACTGCGtGaa
ggCCGCGATCCCGTCggaCGGAAAaCGCCcTGGCCCGGGAaCATACCGTTCGGGCCGCCA
AGTGTTATAGCCGGACCACTTGTCAGAACATTTCCaaTCCGAAGATGTGAGTtCGGAAGg
TAAAAGCCCGACAAGTTGCGCGgTGAATTTACCTTtACcGCACGATATGCGTCCGTATTA
AaGAAAaGTTCGAAATTATCAGTAAGGCCGACCTGAAaGCTGACCGGGAGTTCAACAAAA
TCTGCATCACCcGGgTCACGGTCGAAATTGCTGTACGCGGCGCTGAACGTAAATTCACCC
TTTcTAAGGGTGTCGCcGTCGTAAACCGTAAaCAaGCCGGTAGCGCCGCCCATCGGGCCG
CCGGTACCAACCGTCGGTGCCGTGTTTCTtGCATCATTGTCCGATCGAGCGTTCTCGTCC
GCTTGTGCAAaTCCTGCAaTAGCTAACGTGAAAACGATCAGAGCTGTTGTAAATACTCTA
TAAGCGAGATTCATCACATTCCTCcGCCGAAATAAAAAGTTAATTt
>contig00002 length=554 numreads=4
TGCGCCAaCCGCGCTCTtCATAAaTGGGCACTGCTCCCGATGGCCgACTCGGGCGGTTCG
CCATGAGATCTTTGCCtACCcAGgAaCtCACcACCAAGTCTGATTGCTGTGTGTTTtCTT
CAAGTCCCTATTTCTATTCtCTTtAATGGAACCCGTAGGAAACCCGTGTAGGACGCGGGA
aCCGCACTTgAAGGGGGAGGCGCGGGGTACCGGtCCGGGAACGTACGGGTACCGGCGGGG
gAGGGGAGGGGGACCgCTCCGGGAAGGCCAGGGGACGGATTGGGGAAGGgCGGGTACCGA
AGCGGGgAAaTGGGggAaCcGGCGAGAGGGTTCCTCGCTAAGTGGGGGAAATaGGGGAAA
GGTTGACCAGTGGTtCCCcGCTCTCGTAACATGCCTCAGATAGCGCCATCCGCTGTACCT
GGtcaggtcGctggcaacttcggccgagcaggtgaacccgaaaggtgagggtcagtgtga
cacaccaaccgaacaccgacgaggcaagcgtaggagccggcgtggccgcgcccggcggcg
ctgaggactcctcg
Code to read the sequence may be found here.
It gives the proper output, as shown below with tab seperation:
contig00001 586 52.38
contig00002 554 62.45
The problem is that I developed a form in NetBeans that consists of a JTable having 5 columns i.e:
"contigID","Description","Organism","Sequence_length","Gc_percentage"
and a JTextArea. I want to display the above output in the JTable columns, while the other columns remain empty; and when I click 'contig00001' in JTable, then respective sequence like "CGGGAAAT...." should be displayed in the JTextArea.
How can I do that? Any suggestion would be appreciated.
I'm not exactly sure what you're stuck on. If it's adding data to the JTable, I'd consider creating a DefaultTableModel object, constructing it with the correct column header Strings in an array, with 0 rows of data, and then adding rows of data as you read through your files. The JTable tutorial should help you do all of this. Once you have your table model created, you can add it to your JTable easily via its setModel method.
One approach is to extend AbstractTableModel, as discussed in Creating a Table Model.
Addendum: By listening for a user selection, you can determine which row was selected and update your JTextArea accordingly.
Addendum: Because data retrieval may be prtotracted, SwingWorker offers a safe way to mutate the TableModel. Here's a simple example.

JFace TableViewer - Format cells depending on other cells

I have a JFace TableViewer. The values in one column should normally be unique, but there are cases where it makes sense that they are not (e.g. when a row was copied and not yet changed). However I want to alert the user of the duplicate values by highlighting the rows which contain duplicate values in that column. What's the best way to do this? The LabelProvider seems to only give me access to the current cell or at most the current row.
Thanks,
Thomas
To detect duplicate across the whole table, I guess you got to have some kind of map or set containing all the cell's data. The way I did was to put such map in the view (TableViewer container) and then have label provider holding a link to that view (hence the map). So from within label provider, it is able to detect duplicate and respond accordingly.

JTable RowFilter

Is is possible to some how get the index of the selection corresponding to the non filtered table?
After the table is filter using a regexFilter. JTable getSelectedRow returns the index of the filtered table?
If you are using the built in TableRowSorter functionality from 1.6 you can use the convertRowIndexToModel() on the table. This is give you the unfiltered index of the selected row.
The javadoc for JTable gives a description of this:
Coordinate conversions will be
necessary when using the row based
methods of JTable with the underlying
TableModel. All of JTables row based
methods are in terms of the RowSorter,
which is not necessarily the same as
that of the underlying TableModel. For
example, the selection is always in
terms of JTable so that when using
RowSorter you will need to convert
using convertRowIndexToView or
convertRowIndexToModel.
store the row id in your datamodel, when you get the selected row from jtable, query that rows ID.

Categories