How can I add a List to the JLabel? - java

I'm writing Java game right now, I have a problem that I have a List which type is Ranking, with the fields name and score, and I would like to add that fields to the JLabel. Method setText() unfortunately doesn't fix. What should I do?

with the fields name and score
A JLabel is not designed to display multiple lines of text.
You can format the text using HTML.
Or I would suggest a better approach is to use a JTable, which is designed to display data in a row/column format.
Read the section from the Swing tutorial on How to Use Tables for more information and working examples.
I have a List which type is Ranking
You may also want to check out Row Table Model for an example of a custom TableModel show how you can display your Ranking object in a table.

Related

How update a jlist swing java

I had a problem. I am code a simple dictionary by using java swing
I want first to show all word and then whẹn i type a word or first of a word , it wI'll display this sublist . I try much but not successful, may someone help me
Instead of using a JList you could use a single column JTable. A JTable supports the ability to filter the rows of data in the table.
Read the section from the Swing tutorial on Sorting and Filtering for a working example to get you started.
You can even make the JTable look more like a JList by following these suggestions: How to create a JTable which appears as JList?

Custom component for JList instead of just strings

I've been trying to freshen up on my Java knowledge and I've been building a small GUI program and I've been running into a bit of a problem.
Basically, I have a JList which I'm currently populating with strings from an object from one of my classes which implement AbstractListModel which we can call my ItemList class. It contains an ArrayList of objects of the type Item which implements Serializable.
But, what I'd like to do is rather than populate my JList with a bunch of strings I'd like to populate it with some kind of string + JTextField combination so I can see one property of each Item object while also being able to update another property by changing the JTextField.
Now, what I'm looking for is the simplest possible way of doing this, and I am assuming there is a (relatively) simple way to do this since it's such a common thing to want to do in a GUI application (although I wouldn't put it past Java and Swing to make it convoluted and complicated).
So, what is the correct way of doing this?
No need to ever use String objects. Instead:
Put Item objects in the JList.
Add a ListCellRenderer to the list, to show the Item object the most user friendly way.
When the user selects an item, show the details in a different place (I'm thinking a panel with 2 columns of labels and text fields, and two rows - one for each attribute, and perhaps a button to Save)
The edit controls would best be encapsulated in a panel that can then hidden when not required, & put in a variety of places, e.g.
Below the list
In the main part of the GUI
displayed in a JOptionPane or a (modal or not) JDialog
Here is an example of placing the 'view/edit panel' (the file details) below the selection component (the table).

Create a properties frame in Java

I am trying to make a properties frame just like the one in netBeans (or Visual Studio). My problem is that I don't know exactly how to design it. First I thought I'll make it with JTable (2 columns, multiple rows) but then I realised that on the second column I will have different types of values (booleans, String, color choosers, etc.), but I think that JTable allows only 1 type of data to be placed in a column.
I would like someone to tell me "JTable allows multiple data types on the same column" and show me how to do it, or tell me a different approach to the problem.
You can perfectly tell a JTable to have a column that contains Object, this way you will be able to put whatever ou want in.
BUT.
You'll then have to implement a very good TableCellRenderer/TableCellEditor pair in order to display whatever the cell contains.
Another option would be to use a Grid or GridBag layout inside of a JScrollPane, then dynamically populate the cells of the grid with different editors depending on the data type of the property.
If you can use external libraries, the JGoodies FormLayout is really suited to create such dialogs. Just take a look at the screenshots in their demo.
There is also a rather good PDF available containing with some examples and explanations.

Help with Java program (Swing + database)

Could somebody give me a suggestion on how to simply and effectively make GUI representation of directories which are contained inside the database. Now, getting information using SQL queries is one thing. I can do that.
In fact using separate small examples I can put a file inside the database along with his information and I can get the file out of the database. The thing is I was just doing this without GUI, just to test does it work.
Now I need a GUI of this and I really don't know where to start. DO I use JTable, JList or something third? Also, I think I need an multidimensional array because I have, for example, id of a file, name_of_file and size.
So I need different types to put them in: int, String and int.
Also, I need to obviously hide the id of a file from the user yet keep it at the same time in order to be able to reference it.
How do I hide it in a GUI component?
So, let's say that I have a database table for files with these columns:
id, name, size, binary_of_file.
My real table has a bit more of columns like, id of a parent directory, id of a owner, etc. but for now this is not important.
So, I tell database to give me all info about the file (except it's binary because I just want to list the files):
...
ResultSet rs = statementObject.executeQuery("SELECT id, name, size FROM Files;");
while(rs.next()){
//Where do I store the values in? Which GUI component and how?
...
I guess I need an JPanel that will contain this component that will show my files from the database. What component? Please help!
It sounds like you want to use a JTable, it has a TableModel interface that you can implement to adapt to your resultset.
Also follow the link at the top of the docs. to Creating a Table Model.
Perhaps a combined JList/JTable component would fit this need.
That is a screen shot of the GUI of FileBro.
My idea is that the JTree on the left would represent the 'directories' and table (names) of the DB. The JTable on the right would contain the data of the selected table. Change the Locate Open Edit Print buttons for Create Update Delete and the panel below that to show details of records, and it would be the start of a DB CRUD component.

Steps to read the text file into specific columns of JTable using biojava

Here is a typical input .txt file (also called as fasta file):
>contig00001 length=586 numreads=4
CGGGAAATTATCcGCGCCTTCACCGCCGCCGGTTCCACCGACGAACGGATACTGCGtGaa
ggCCGCGATCCCGTCggaCGGAAAaCGCCcTGGCCCGGGAaCATACCGTTCGGGCCGCCA
AGTGTTATAGCCGGACCACTTGTCAGAACATTTCCaaTCCGAAGATGTGAGTtCGGAAGg
TAAAAGCCCGACAAGTTGCGCGgTGAATTTACCTTtACcGCACGATATGCGTCCGTATTA
AaGAAAaGTTCGAAATTATCAGTAAGGCCGACCTGAAaGCTGACCGGGAGTTCAACAAAA
TCTGCATCACCcGGgTCACGGTCGAAATTGCTGTACGCGGCGCTGAACGTAAATTCACCC
TTTcTAAGGGTGTCGCcGTCGTAAACCGTAAaCAaGCCGGTAGCGCCGCCCATCGGGCCG
CCGGTACCAACCGTCGGTGCCGTGTTTCTtGCATCATTGTCCGATCGAGCGTTCTCGTCC
GCTTGTGCAAaTCCTGCAaTAGCTAACGTGAAAACGATCAGAGCTGTTGTAAATACTCTA
TAAGCGAGATTCATCACATTCCTCcGCCGAAATAAAAAGTTAATTt
>contig00002 length=554 numreads=4
TGCGCCAaCCGCGCTCTtCATAAaTGGGCACTGCTCCCGATGGCCgACTCGGGCGGTTCG
CCATGAGATCTTTGCCtACCcAGgAaCtCACcACCAAGTCTGATTGCTGTGTGTTTtCTT
CAAGTCCCTATTTCTATTCtCTTtAATGGAACCCGTAGGAAACCCGTGTAGGACGCGGGA
aCCGCACTTgAAGGGGGAGGCGCGGGGTACCGGtCCGGGAACGTACGGGTACCGGCGGGG
gAGGGGAGGGGGACCgCTCCGGGAAGGCCAGGGGACGGATTGGGGAAGGgCGGGTACCGA
AGCGGGgAAaTGGGggAaCcGGCGAGAGGGTTCCTCGCTAAGTGGGGGAAATaGGGGAAA
GGTTGACCAGTGGTtCCCcGCTCTCGTAACATGCCTCAGATAGCGCCATCCGCTGTACCT
GGtcaggtcGctggcaacttcggccgagcaggtgaacccgaaaggtgagggtcagtgtga
cacaccaaccgaacaccgacgaggcaagcgtaggagccggcgtggccgcgcccggcggcg
ctgaggactcctcg
Code to read the sequence may be found here.
It gives the proper output, as shown below with tab seperation:
contig00001 586 52.38
contig00002 554 62.45
The problem is that I developed a form in NetBeans that consists of a JTable having 5 columns i.e:
"contigID","Description","Organism","Sequence_length","Gc_percentage"
and a JTextArea. I want to display the above output in the JTable columns, while the other columns remain empty; and when I click 'contig00001' in JTable, then respective sequence like "CGGGAAAT...." should be displayed in the JTextArea.
How can I do that? Any suggestion would be appreciated.
I'm not exactly sure what you're stuck on. If it's adding data to the JTable, I'd consider creating a DefaultTableModel object, constructing it with the correct column header Strings in an array, with 0 rows of data, and then adding rows of data as you read through your files. The JTable tutorial should help you do all of this. Once you have your table model created, you can add it to your JTable easily via its setModel method.
One approach is to extend AbstractTableModel, as discussed in Creating a Table Model.
Addendum: By listening for a user selection, you can determine which row was selected and update your JTextArea accordingly.
Addendum: Because data retrieval may be prtotracted, SwingWorker offers a safe way to mutate the TableModel. Here's a simple example.

Categories