Filtering JTable with JComboBox generates ArrayIndexOutOfBoundsException - java

I created a GUI which contains a JComboBox and a JTable. The JTable is filled with data from an Access Database. The JComboBox is used to filter the JTable.
When I select an item from the JComboBox the JTable shows the correct data. But if I first select a row from the JTable and select another item from the JComboBox I get the following error:
java.lang.ArrayIndexOutOfBoundsException: -1
What’s the problem here?

Any time you throw an ArrayIndexOutOfBoundsException the issue lies in that you are trying to select data that lies outside the working area for the data set (Array in this example. Arrays use 0 based indexing). First I would ensure the data in your JTable is correct, then I would look at how the relationship between the JTable and JComboBox is defined.
Would be easier if you also included some of your code so we could actually see the error in your design. Best of luck!

Related

How update a jlist swing java

I had a problem. I am code a simple dictionary by using java swing
I want first to show all word and then whẹn i type a word or first of a word , it wI'll display this sublist . I try much but not successful, may someone help me
Instead of using a JList you could use a single column JTable. A JTable supports the ability to filter the rows of data in the table.
Read the section from the Swing tutorial on Sorting and Filtering for a working example to get you started.
You can even make the JTable look more like a JList by following these suggestions: How to create a JTable which appears as JList?

How to add checkboxes to a JTable which uses a model with values from a database?

I have a model(AbstracTableModel) which I use to build a JTable.
The thing is that the table cell values seen in the GUI are displayed from a database.
How can I add a new column with checboxes for each row of the table?
Is there a concrete answer to this?
The thing is that the table cell values seen in the GUI are displayed from a database.
Use a DefaultTableModel to store the data from the database.
See the TableFromDatabaseExample.java code found in Table From Database for simple code to load the DefaultTableModel.
How can I add a new column with checboxes for each row of the table?
You can modify the above code to add an extra column to the "columnNames" Vector. Then in the looping code you add a Boolean.FALSE object to the "row" Vector.
Or, after creating the DefaultTableModel with the data from the database you can use the addColumn(...) method of the DefualtTableModel to create your column of check boxes.

How can delete/hide the mid row(5)th row before it listed in jtable

Here i have an 1-10 row is listed in jtable i want to delete/hide the 5th row before it listed in jtable.
i set the rowheight but it affected the cellselection.Is there any way to hide/delete the row without affected the normal flow code?
If i remove the row it will throws ArrayIndexoutofBoundException.
in my project executed means one gui open in that gui listed the some string. In here we can add the more string via Add Button on popup Button
Here what i need is i have to hide the particular string. That string is placed on 1st row.
i need to hide the string from end user.
now u hope understand.
You can use the JTable row filtering support in order to hide certain rows without deleting them from the model. Also see this: How can I filter rows in a JTable?
You can eliminate rows in the table by calling the removeRow() method. If you want to just hide it instead of elimintaing it you need to customize the JTable's model to meet your specs on what to display.
http://docs.oracle.com/javase/tutorial/uiswing/components/table.html
using DefaultTableModel with JTable you should be able to use model.removeRow(int row) function to remove A row from JTable. There is no way to hide a row based on index as much as i know. However, If you need to hide and re-show mechanism you need to save the row prior to delete it and Save the removedRow in a ArrayList to re-use them.. Something as follows:
List<Vector>deletedRows = new ArrayList<>();
Vector removingRow = (Vector) model.getDataVector().get(5);
deletedRows.add(removingRow);
model.removeRow(5);

Get index of dynamic checkbox in java

I have dynamic checkbox in jtable , I do it by this code
TableColumn tcolumnas = jTable1.getColumnModel().getColumn(3);
tcolumnas.setCellRenderer(jTable1.getDefaultRenderer(Boolean.class));
tcolumnas.setCellEditor(jTable1.getDefaultEditor(Boolean.class));
and I want if I check one of them I want to know the index of check box.
Hearing for your suggestion
http://i.stack.imgur.com/tskSw.png
UPDATE :
the solution is veeery simple as here
Java Getting JTable Value (Per row)
You can add a TableModelListener to the TableModel. An event will be fired any time the data in a cell is changed.

Steps to read the text file into specific columns of JTable using biojava

Here is a typical input .txt file (also called as fasta file):
>contig00001 length=586 numreads=4
CGGGAAATTATCcGCGCCTTCACCGCCGCCGGTTCCACCGACGAACGGATACTGCGtGaa
ggCCGCGATCCCGTCggaCGGAAAaCGCCcTGGCCCGGGAaCATACCGTTCGGGCCGCCA
AGTGTTATAGCCGGACCACTTGTCAGAACATTTCCaaTCCGAAGATGTGAGTtCGGAAGg
TAAAAGCCCGACAAGTTGCGCGgTGAATTTACCTTtACcGCACGATATGCGTCCGTATTA
AaGAAAaGTTCGAAATTATCAGTAAGGCCGACCTGAAaGCTGACCGGGAGTTCAACAAAA
TCTGCATCACCcGGgTCACGGTCGAAATTGCTGTACGCGGCGCTGAACGTAAATTCACCC
TTTcTAAGGGTGTCGCcGTCGTAAACCGTAAaCAaGCCGGTAGCGCCGCCCATCGGGCCG
CCGGTACCAACCGTCGGTGCCGTGTTTCTtGCATCATTGTCCGATCGAGCGTTCTCGTCC
GCTTGTGCAAaTCCTGCAaTAGCTAACGTGAAAACGATCAGAGCTGTTGTAAATACTCTA
TAAGCGAGATTCATCACATTCCTCcGCCGAAATAAAAAGTTAATTt
>contig00002 length=554 numreads=4
TGCGCCAaCCGCGCTCTtCATAAaTGGGCACTGCTCCCGATGGCCgACTCGGGCGGTTCG
CCATGAGATCTTTGCCtACCcAGgAaCtCACcACCAAGTCTGATTGCTGTGTGTTTtCTT
CAAGTCCCTATTTCTATTCtCTTtAATGGAACCCGTAGGAAACCCGTGTAGGACGCGGGA
aCCGCACTTgAAGGGGGAGGCGCGGGGTACCGGtCCGGGAACGTACGGGTACCGGCGGGG
gAGGGGAGGGGGACCgCTCCGGGAAGGCCAGGGGACGGATTGGGGAAGGgCGGGTACCGA
AGCGGGgAAaTGGGggAaCcGGCGAGAGGGTTCCTCGCTAAGTGGGGGAAATaGGGGAAA
GGTTGACCAGTGGTtCCCcGCTCTCGTAACATGCCTCAGATAGCGCCATCCGCTGTACCT
GGtcaggtcGctggcaacttcggccgagcaggtgaacccgaaaggtgagggtcagtgtga
cacaccaaccgaacaccgacgaggcaagcgtaggagccggcgtggccgcgcccggcggcg
ctgaggactcctcg
Code to read the sequence may be found here.
It gives the proper output, as shown below with tab seperation:
contig00001 586 52.38
contig00002 554 62.45
The problem is that I developed a form in NetBeans that consists of a JTable having 5 columns i.e:
"contigID","Description","Organism","Sequence_length","Gc_percentage"
and a JTextArea. I want to display the above output in the JTable columns, while the other columns remain empty; and when I click 'contig00001' in JTable, then respective sequence like "CGGGAAAT...." should be displayed in the JTextArea.
How can I do that? Any suggestion would be appreciated.
I'm not exactly sure what you're stuck on. If it's adding data to the JTable, I'd consider creating a DefaultTableModel object, constructing it with the correct column header Strings in an array, with 0 rows of data, and then adding rows of data as you read through your files. The JTable tutorial should help you do all of this. Once you have your table model created, you can add it to your JTable easily via its setModel method.
One approach is to extend AbstractTableModel, as discussed in Creating a Table Model.
Addendum: By listening for a user selection, you can determine which row was selected and update your JTextArea accordingly.
Addendum: Because data retrieval may be prtotracted, SwingWorker offers a safe way to mutate the TableModel. Here's a simple example.

Categories